1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr402 [8]
3 years ago
13

What is an infection of the urinary bladder called?

Biology
1 answer:
GalinKa [24]3 years ago
7 0
<span>Cystitis is the medical term, usually a bacterial infection and can be abbreviated as a U.T.I (urinary tract infection)</span>
You might be interested in
How are viruses and bacteria different?
Ivahew [28]

Viruses go around in the air and bacteria you have to touch

8 0
3 years ago
Read 2 more answers
The roots of many clover plants produce structures that are filled with bacteria. The clover plants provide food and shelter for
ivanzaharov [21]

The type of relationship that occurs between the clover plants and the bacterias is called mutualism.

<h3>What is Mutualism?</h3>

Mutualism is an ecological relationship between individuals of different species, in which both are benefited by the interaction. As it occurs between individuals of different species, it is a so-called interspecific relationship, and, as it benefits all those involved, it is called a harmonic relationship.

See more about ecology at: brainly.com/question/25953800

#SPJ1

7 0
1 year ago
Scrivi tutti gli isomeri dell’esano
MaRussiya [10]

Answer: i cinque isomeri possibili per l'esano sono n-esano, 2-metil pentano, 3-metil pentano, 2, 3-dimetilbutano e 2, 2-dimetilbutano. - 2-metil pentano è anche chiamato isoesano. - 2, 2-dimetil butano chiamato anche Neoesano.

Explanation:

7 0
2 years ago
When bonds are broken, energy is released.<br> True or false
Elza [17]
False. <span>Breaking Bonds → Energy Absorbed
</span>
You have to put energy into a molecule to break its chemical bonds. The amount needed is called the<span> bond energy</span><span>. If you think about it, molecules don't spontaneously break.
</span>

5 0
3 years ago
Read 2 more answers
5.
almond37 [142]
Improve health
False
Using genetic principles to calculate
8 0
3 years ago
Other questions:
  • Exposure to environmental hazards such as coal dust, silica dust, and asbestos may lead to pulmonary fibrosis or scarring of the
    8·1 answer
  • Explain why scientists believe that warm climates provide greater biodiversity.
    11·2 answers
  • Geoscientists use ___________ to explore the deep layers of the earth that humans can not yet dig down into.
    8·1 answer
  • Which is true for both photosynthesis and cellular respiration?
    13·1 answer
  • Which is more factory heavy goats or sheep?
    14·2 answers
  • You have a DNA sequence that codes for a protein and is 105 nucleotides long.A frame shift mutation occurs at the 85th base how
    7·1 answer
  • Disturbances to an ecosystem, such as fires and floods, are often seen as negative. Describe a situation where
    9·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • After mitosis are the two new daughter cells diploid or haploid?
    12·2 answers
  • Which was most likely an effect on society that resulted from improvement in handling blood during world war l and world war ll?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!