What can scientists use to determine the type of plant an organism consumed?

2 answers:

3 0

Answer: Carbon 12 and Carbon 13

In plant, the ratio of carbon 12 and carbon 13 isotopes is different depending upon the plant photosynthesis. The distribution of these isotopes in plant tissue can indicate the path way of carbon metabolism that is either C3 fixation or C4 fixation. This help scientist to know if the plant consumed by organism is C3 plant or C4 plant by measuring the isotopic signature of their collagen and other tissues.

This can help scientist know which plant is consumed by animals.

pychu [463]2 years ago

3 0

<h2>Type of Plant an Organisam Consumed - Option A</h2>

Carbon 13 and Carbon 12 can scientists use to determine the type of plant an organism consumed. Carbon 12 and 13 are isotopes of carbon. In the plant, the ratio of carbon 12 and carbon 13 isotopes is not same it just depends upon the plant photosynthesis.

The division of these isotopes in plant tissue can show the pathway of carbon metabolism that can be C3 fixation or C4 fixation. From this, the scientist can determine which animal consumed plant is C3 plant or C4 plant by estimating the isotopes of their collagen and other tissues.

You might be interested in

We refer to the Dna code as being redundant or repetitive. This means that

KengaRu [80]

I think but I do not know it refered to as being repetitive

8 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Rarefaction is used for which of the following?

ratelena [41]

Rarefaction in terms of ecology can be defined as a technique used to assess species richness from the results of sampling.

It allows the calculation of richness of a particular species for a given number of individual samples, and these are based on the construction of rarefaction curves.

Hence, the correct answer is: option A-Creating a representative sample

3 0

3 years ago

Read 2 more answers

The first stage of cellular respiration, called _____________, takes place in the cytoplasm of the cell and needs no oxygen.

laila [671]

The first stage is glycolysis

5 0

3 years ago

If you had $5000 what would you do with it and why?

dalvyx [7]

Answer: