During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
A is the answer. This answer is also a question, and the answer to that question is 0.25
Answer:
Step-by-step Explanation:
Answer:
The correct answer will be-<em> </em><em>Homo neanderthalensis</em>
Explanation:
The closest ancestor of modern humans which evolved in the Pleistocene age which was around 7 lakh to 3 lakh years is the <em>Homo neanderthalensis</em> or Neanderthals.
The Neanderthals became extinct around 12,000-10,000 years ago by competitive <em>Homo sapiens</em>.
The specimens of Neanderthals are collected from the central and Western Asia and parts of Europe and showed approximately the same cranial capacity which is around 1450-1500 cc.
Thus, <em>Homo neanderthalensis</em> is the correct answer.
Answer:
motion and kinetic energy
Explanation:
