1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arisa [49]
3 years ago
10

What is the difference between a species in a population

Biology
1 answer:
Gala2k [10]3 years ago
5 0
Species are single organisms that are able to reproduce, while a population is a group of species living in the same general area.
You might be interested in
Eugene is listing the colors of the various atoms within the molecules. He would use the color ____________ to show carbon.​
erik [133]

Answer: black (graphite), transparent (diamond)

Explanation:

8 0
3 years ago
Read 2 more answers
What is the most superior upper body muscle?
Vlad1618 [11]
Obturator Externus

Obturator Externus: This is one of the smaller muscles of the medial thigh, and it is located most superiorly.
8 0
3 years ago
Read 2 more answers
What do scientists often use to make a prediction
77julia77 [94]

Answer:

hypothis

Explanation:

5 0
3 years ago
Read 2 more answers
What is odontoid process in bones/
Rom4ik [11]

Answer:

<h3>The odontoid process</h3>

It exhibits a slight construction or neck, where it joins the main body of the vertebra...

<h3>Hope you like it please mark me as a brainliest </h3>
7 0
3 years ago
How much faster than normal extinction have humans caused extinction rates to climb?
Nutka1998 [239]

Answer:

poaching

Explanation:

3 0
3 years ago
Other questions:
  • Which statement is an example of a scientific theory
    11·2 answers
  • Define "water pollution".
    11·2 answers
  • Why does hurricane season occur from late spring through fall in the Atlantic region?
    12·2 answers
  • Why do scientists need a geological time scale?
    9·1 answer
  • Which statements are true of geothermal energy? Check all that apply.
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The delivery of oxygenated blood to all tissues around the body involves what two life functions? A) Digestive and circulatory B
    11·1 answer
  • Science question. will give brainliest! part 4!
    8·2 answers
  • Based on the pyramid and what you know about iron, do you think you get enough iron in your diet?
    5·1 answer
  • Two chromosomes that look alike and have the same sequence of genes in the same positions are a(n) ______ pair.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!