1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DENIUS [597]
3 years ago
15

Chlorophyll is found in plant leaves and absorbs light from the sun to enable plants to perform photosynthesis. Magnesium is an

important component of chlorophyll. The concentration of magnesium ions is higher in the root-hair cells of plants than in the soil. Which mechanism of ion uptake would best enable a plant to produce a steady supply of chlorophyll?
osmosis
diffusion
passive transport
active transport
Biology
1 answer:
yawa3891 [41]3 years ago
4 0

Answer:

active transport D

Explanation:

You might be interested in
Plz help/will give brainliest!​
melisa1 [442]
Heterozygous is when an individual carries two different alleles for a given gene.
6 0
3 years ago
What can be an example of a unicellular eukaryotic organism?​
Maru [420]
Yeasts and algae is an example of eukaryotic organism
4 0
3 years ago
You have been dispatched to a residence where a woman lacerated her arm after falling while holding a drinking glass. She inform
miss Akunina [59]

Answer:

The answer is B.

Explanation:

According to the details given in the example, because she cut a blood vessel, the blood vessel, using the muscles along the walls of the vessel, constricted as quickly as possible once it was cut to be able to stop the bleeding. So the answer is option B.

I hope this answer helps.

5 0
3 years ago
Refer to the diagram to answer this question.
BlackZzzverrR [31]

Answer:

Sexual reproduction produces genetic variation in offspring.

Explanation:

4 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Other questions:
  • Bears and salmon have a predator-prey relationship. What would most likely happen to the bear population if the salmon populatio
    11·1 answer
  • Accusing people of dwe (driving while elderly) is considered a type of
    6·1 answer
  • What is the role of enzymes in the DNA replication process?
    8·2 answers
  • Why are olfaction and gustation called chemical senses? Neither one has sensory receptors that respond to molecules in the food
    6·1 answer
  • Non-photosynthesizing organisms (like humans) must obtain which three basic types of nutrients from their environment?
    14·1 answer
  • Which set of details correctly identifies a series of events in a sympathetic pathway?
    7·1 answer
  • Why do desert plants need the waxy coating on their leaves to survive?
    6·2 answers
  • Which behavior shows a way that animals defend their territory
    8·2 answers
  • What are the filaments called that help some bacteria stick to surfaces and exchange plasmids through conjugation?
    8·1 answer
  • For "Ocean to Continent" Convergent Plate Movement, Describe what is happening and the Geological result
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!