1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
motikmotik
3 years ago
9

The oldest plant community in glacier bay is hemlock-spruce forest. you would predict that hemlock and spruce trees are _____-st

rategists.
Biology
1 answer:
Savatey [412]3 years ago
4 0
Since the hemlock and spruce trees are old, they are K-strategists. K-selected species, or K-strategists, are species that produce only a few offspring that live for a long time. r-selected species, or r-strategists, on the other hand are able to produce more offspring which survive for a shorter period of time. 
You might be interested in
Farming is ________ due to a scarcity of water
mrs_skeptik [129]
"harder" as most crops require water 
5 0
4 years ago
What is one reason some leaves are spiny or needle shaped
Lady bird [3.3K]
To reduce water loss from leaves in dry climates
5 0
3 years ago
Who created a method for detecting arsenic in murder victims?
Pavel [41]

It is called The Marsh Test and it was created by James Marsh.

4 0
3 years ago
Read 2 more answers
What part of the cell is selectively permeable and critical for maintaining homeostasis?
Diano4ka-milaya [45]

Answer:

The cell membrane

Explanation:

One way that a cell maintains homeostasis is by controlling the movement of substances across the cell membrane. The lipid bilayer is selectively permeable to small, nonpolar substances. Proteins in the cell membrane include cell-surface markers, receptor proteins, enzymes, and transport proteins.

5 0
3 years ago
Helppp it’s super hard
Slav-nsk [51]

Answer:

false

Explanation:

ozone its own gas

8 0
4 years ago
Read 2 more answers
Other questions:
  • Differentiate between various types of meristem on the basis of position?
    5·1 answer
  • Fossil fuels are formed by the decomposition of dead plants and animals. Which flow chart describes the correct energy transform
    8·2 answers
  • It is estimated that half of all conceptions have too many or too few chromosomes. According to the text, what happens to most o
    7·1 answer
  • There are many classes of compounds that are pharmaceuticals. So called 'Small Molecules' such as aspirin, have been useful in m
    7·1 answer
  • 1. What are the key players in translation?
    13·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which of the following best describes why a scene like this is not realistic? A. Sound cannot produce vibrations. B. Sound needs
    8·1 answer
  • What special structures are needed for green plants?
    11·2 answers
  • What is the name of this organelle?
    10·2 answers
  • If a sample of water is 200°F and cools down until freezing, how many degrees celsius did it change?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!