1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RoseWind [281]
3 years ago
6

Which of the following prefixes represents the smallest value

Biology
1 answer:
Alja [10]3 years ago
6 0
The smallest prefix is deci.
You might be interested in
When we breathe in and out normally during rest, this is called “quiet” inspiration (and expiration). It is also called tidal vo
topjm [15]

Answer: the amount of air that normally enters the lungs during quiet breathing, which is about 500 milliliters.

Explanation:

5 0
3 years ago
Your patient tells you he is a jehovah's witness. what should you do to show your support for his spiritual beliefs?
Wittaler [7]
Get to know your patient, learn more about it. that will show that you support his/her believes.
6 0
3 years ago
A molecule that can be used as a molecular clock has a neutral mutation rate of one mutation per 5 million years. How many years
gregori [183]

Answer:To put dates on events in evolutionary history, biologists count how many mutations have accumulated over time in a species’ genes. But these “molecular clocks” can be fickle. A paper in the 28 September Physical Review Letters mathematically relates erratic “ticking” of the clock to properties of the DNA sequence. Researchers may eventually use the results to select which genes make the best clocks.

Although mutations in DNA are rare, they are crucial for evolution. Each mutation in a gene changes one small piece of a protein molecule’s structure–sometimes rendering it non-functional and occasionally improving it. The vast majority of mutations, however, neither hurt nor help, often because they affect an unimportant part of their protein. Such a “neutral” mutation usually dies out over the generations, but occasionally one proliferates until virtually every individual has it, permanently “fixing” the mutation in the evolving species.

Over thousands of generations, these fixed mutations accumulate. To gauge the time since two species diverged from a common ancestor, biologists count the number of differences between stretches of their DNA. But different DNA segments (genes) often give different answers, and those answers differ by much more than would be expected if the average rate of mutations remained constant over evolutionary time. Sometimes they also disagree with dates inferred from fossils. Now Alpan Raval, of the Keck Graduate Institute and Claremont Graduate University, both in Claremont, California, has put precise mathematical limits on this variation.

Raval’s work is based on representing possible DNA sequences for a gene as a network of interconnected points or “nodes.” Each point represents a version of the gene sequence that differs by exactly one neutral mutation–a single DNA “letter”–from its immediate neighbors. The network contains only neutral mutations; non-functional versions of the sequence aren’t part of the network.

Models and simulations had suggested that if the number of neighbors varies from point to point–that is, if some sequences allow more neutral mutations than others–mutations accumulate erratically over time, making the molecular clock unreliable. Raval calculates precise limits on how unsteady the clock could get, based on properties of the network, such as the average number of neighbors for each node or the number of “jumps” connecting any two randomly chosen nodes. “The great strength of this paper is that it’s now mathematically worked out in much more detail than before,” says Erik van Nimwegen of the University of Basel and the Swiss Institute of Bioinformatics in Switzerland, who developed the framework that Raval uses.

Still, the relevant network properties are “not very intuitive,” van Nimwegen observes. Raval agrees. “The real question from this point on would be to identify what kinds of proteins would be good molecular clocks.” He says that according to his results, for a protein to be a good clock, “virtually all single mutations [should] be neutral”–many neighbors per node–but “as you start accumulating double and triple mutants, it should quickly become dysfunctional.” Raval is working to relate these network features to protein properties that researchers could measure in the lab.

Researchers have suggested other explanations for the erratic behavior of molecular clocks, such as variations in the mutation rate because of changes in the environment. But such environmental changes are relatively fast, so their effect should average out over evolutionary time, says David Cutler of Emory University in Atlanta. He says that in network models, by contrast, changes in the mutation rate are naturally slow because the point representing the current sequence moves slowly around the network as mutations accumulate.

Explanation:

4 0
3 years ago
Read 2 more answers
Tor F: Prescription drugs and over-the-counter drugs are the same thing
vovikov84 [41]

Answer:

False

Explanation:

6 0
4 years ago
Read 2 more answers
What is the chemical basis of gene
Artemon [7]

The anwer is DNA to your question

8 0
3 years ago
Other questions:
  • What is the name for the "in between" phase in cell divisions?
    7·2 answers
  • An individual's ability to remember the day he or she first swan the length of a swimming pool is most clearly an example of ___
    5·1 answer
  • A football player in full uniform has been stung by a bee. your assessment reveals him to be confused with stridorous respiratio
    14·1 answer
  • In a controlled experiment what ter m is used to describe the many factors that might be different between the experiment and co
    12·2 answers
  • What is a disadvantage of having a cloned flock??
    10·1 answer
  • Please help me!
    6·2 answers
  • which atom is found in all organic substances but rarely in organic substances? a.carbon b.oxygen c.nitrogen d.phosphorus
    15·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Why the pulmonary arteries have light violet blood?​
    5·1 answer
  • Why is it necessary for the human body to maintain homeostasis?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!