1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashcka [7]
3 years ago
10

Explain why something with only one cell can be considered to be an organism.

Biology
1 answer:
IgorC [24]3 years ago
4 0
<span> Organism- an individual form of life that is capable of growing metabolizing nutrients, and usually reproducing. </span>regardless of the organism being unicellular or multicellular.
You might be interested in
Forward primer: 5'-AGTCTACTCGTAACCGGTTACC-3' Reverse primer: 5'-TAAGGCATCATGGTAACCGGTT-3' The two primers above have the melting
CaHeK987 [17]

Answer:

Short answer is primers are partially complementary.

Explanation:

Forward primer: 5'-AGTCTACTCGTAACCGGTTACC-3'

Reverse primer: 5'-TAAGGCATCATGGTAACCGGTT-3'

When we write reverse primer 5' to 3' we can easily see that

3'-TTGGCCAATGG---5' is complementary to the forward primers'

5'---AACCGGTTACC-3' sequence. So instead of binding to the template DNA these primers might bind each other resulting with reduction of efficiency of DNA amplification.

5 0
3 years ago
Which organelle would be found in higher concentrations in a muscle cell when compared to other cell types?
notsponge [240]
Mitochondria- it produces the energy for the cell. the muscle needs more energy because they are always functioning
3 0
3 years ago
Read 2 more answers
A student is making a diagram of water cycle. What should draw to illustrate evaporation?
nalin [4]

The diagram of water cycle includes the evaporation of water from water bodies. This is often expressed by an arrow or a bunch of arrows that arise from the water body and point towards the sky.

Some diagrams also symbolically show the evaporation process as water vapor that is symbolised with wavy curved arrows

4 0
3 years ago
Read 2 more answers
Where does photosythesis occure
ANEK [815]

Answer:

in the chloroplasts

4 0
3 years ago
Read 2 more answers
Complex DNA repair mechanisms in many organisms is a challenge to Darwinian evolution because DNA repair is complex involving ma
Anton [14]

Answer:

TRUE

Explanation:

Yes this is true that Complex DNA repair mechanisms in many organisms is a challenge to Darwinian evolution because DNA repair is complex involving many proteins and Darwinian evolution would need to evolve all of these proteins simultaneously. The importance of neutral mutations has emphasized by Evolutionary theory.

DNA repair: The process through which cell repairs it's impaired DNA is called DNA repair process.

6 0
3 years ago
Other questions:
  • Which best describes plant classification?
    11·1 answer
  • From which sphere of earth did this food originate
    5·1 answer
  • 1. How many minutes does it take a P wave to travel 2000 Km?
    15·1 answer
  • Multigene families are Multigene families are groups of enhancers that control transcription. sets of genes that are coordinatel
    5·1 answer
  • When is speciation complete?<br>​
    10·1 answer
  • 2.Which of the following is NOT an example of symbiosis? A. red blood cells containing malaria. B. vines using a tree for suppor
    10·1 answer
  • Fill in the blanks
    11·1 answer
  • What Causes liquids to rise and depends on the strength of adhesion?​
    7·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Simple tissues such as ________ are composed of a single type of cell. Group of answer choices parenchyma cork epidermis secreto
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!