1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
USPshnik [31]
3 years ago
13

What is the function of a cells selectively permeable plasma membrane?

Biology
2 answers:
tatuchka [14]3 years ago
7 0
To allow through certain items while blocking the rest.
ivolga24 [154]3 years ago
5 0

It allows some molecules to enter the cell and blocks entry to others

You might be interested in
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Name 2 ways your body uses carbohydrates
notka56 [123]
- Energy Production (providing energy)
- Energy Storage
- Breakdown of fatty acids
- Building Macromolecues
5 0
3 years ago
Read 2 more answers
What is not a protist genera that parasitizes humans?
UkoKoshka [18]

Answer:

<h2>Chalamydomonas.</h2>

Explanation:

Protists are those organisms that are unicellular and eukaryotic in nature. They are present in diverse forms and structures and show different types of characteristics/. There are many protists that are harmful to human beings and some other organism that causes certain diseases called parasitic protists such as protozoans, trichomonas and some other. There are some protists that are not parasitic in nature such as Chlamydomonas and some other. Protists have different types of the mode of nutrition that may be autotrophic, saprophytic and parasitic and some other.

6 0
3 years ago
Fused digits (F) is a dominant trait. A pedigree for one family is shown on the right, with affected individuals marked by shade
Naddik [55]

Answer: Ff                             Fused digits (F) is a dominant trait. A pedigree for one family is shown on the right, with affected individuals marked by shaded symbols. Use this to answer Question 10.

Question 10

What is the genotype of Individual II-4?

A: FF

B: Ff

C: ff

3 0
3 years ago
Celiac disease is a condition that prevents people from eating food products that contain gluten. Gluten is a protein compound f
Kay [80]

The cytoplasm is responsible for breaking down gluten. it is the first step in cellular respiration.

5 0
3 years ago
Read 2 more answers
Other questions:
  • True or false. the liver is the organ that first receives glucose after it is absorbed into the bloodstream.
    8·1 answer
  • imagine a model of a cell shaped like a cube.Calculate the ratio of surface area to volume for a cell model measures 3 cm on eac
    14·1 answer
  • Explain why we see such diversity between living organisms with only 4 nitrogen bases
    15·1 answer
  • Ecology webquest
    9·1 answer
  • What is the independent variable?
    14·2 answers
  • The female reproductive system in humans differs from the human male reproductive system in that only the female system is respo
    15·2 answers
  • Which of the following events do you think can lead to a mutation?
    6·1 answer
  • Help me plz I dont know this
    5·1 answer
  • True or False. Anything that has molecules doesn’t have heat. Explain your answer.
    8·2 answers
  • Chemical energy is used to do work in cells because the bonds in molecules contain ____________ energy.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!