1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nonamiya [84]
2 years ago
12

Chemical energy is used to do work in cells because the bonds in molecules contain ____________ energy.

Biology
1 answer:
Otrada [13]2 years ago
4 0

<u>Potential energy</u> is the chemical energy stored in the chemical bonds of atoms and molecules.

<h3>What is potential energy?</h3>

Potential energy is the energy stored in the bonds (structural arrangement) of chemical compounds, such as atoms and molecules.

<h3>Characteristics of potential energy</h3>

  • The potential energy that a molecule may have is due to the forces of attraction and repulsion with other molecules in its environment.

  • An example is glucose, which stores chemical potential energy that the body, through metabolism, transforms into heat energy to maintain body temperature.

Therefore, we can conclude that potential energy is stored in the chemical bonds of molecules.

Learn more about potential energy here: brainly.com/question/12450160

You might be interested in
Too much socializing in a work place can ?
Romashka-Z-Leto [24]
Too much socializing can affect work production and accuracy.
6 0
2 years ago
what type of behavior is a caterpillar building a cocoon? A. instinct B. imprinting C. conditioning D. insight learning
Ratling [72]
I believe it is <u>instinct </u>that is the behavior of the caterpillar building a cocoon.
7 0
2 years ago
List the 9 main types of evidence that is compelling for rapid climate change
barxatty [35]

Answer:I got it

Explanation:

Carbon Dioxide Concentrations in the Atmosphere Are Increasing

Global Temperature Rise

Shrinking Ice Sheets

Warming Oceans

Glacial Retreat

Decreased Snow Cover

Sea Level Rise

Declining Arctic Sea Ice

Ocean Acidification

5 0
3 years ago
An operational definition is used for a behavior so that
dezoksy [38]

An operational definition is used for a behavior so that the behavior can be properly described and understood. Without an operational definition, it would be difficult to describe behavior without being subjective. Therefore, behavior cannot be understood and cannot be correctly addressed. It is also important to understand how behavior functions so that the antecedents and consequences of behavior can be observed. Thus, what reinforces or affects the behavior can be better understood. Lastly, an operational definition is objective and specific, therefore, behavior can be described across different settings and times.

8 0
3 years ago
Orchids are flowering plants that depend on bees for pollination. A population of orchids in a rainforest has reached its carryi
Alecsey [184]
Nothing, the carrying capacity would stay the same because it’s a constant factor In the ecosystem.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Where do the nucleotides come from during protein synthesis ? ( transcription)
    14·1 answer
  • explain why biologists say that a cell is alive, but none of the individual molecules inside the cell are alive.
    6·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What component do animals add to the atmosphere when they breathe?
    6·1 answer
  • Is Reproduction necessary for the survival of an individual
    7·2 answers
  • The sun’s energy is most useful to humans after it is converted to _____.
    10·1 answer
  • Elements join together to form A. atomic mases B. compounds C. ions D. protons
    7·2 answers
  • A founding population usually has lower genetic diversity than the original population it came from. For those alleles that are
    5·1 answer
  • Prior to 1900, Mendel was:
    6·1 answer
  • Q2.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!