1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NemiM [27]
3 years ago
15

If a cell is placed inside a solution that has a higher concentration of solute than on the inside of the cell, what can be said

about the movement of water?        A. Water will move out of the cell, causing it to shrivel.   B. Water will move into the cell, causing it to swell.   C. Water will move out of the cell, causing it to swell.   D. Water will move in and out of the cell at the same rate.
Biology
1 answer:
Zolol [24]3 years ago
8 0
WATER WILL MOVE OUT OF THE CELL CAUSING IT TO SHRIVEL. This is because, the more solute a solution contain, the less its probability of crossing a semi permeable membrane into another compartment, this then result in the net flow of water from the region of lower solute concentration to the region of higher solute concentration. Thus, water will flow out of the cell which has lower solute concentration into the surrounding solution which has higher concentration. The outflow of water will make the cell to shrivel.
You might be interested in
The light- ____ reactions occur in thylapidary membranes?
Papessa [141]
I think it's light dependent and the light independent take place outside the thylakoid membranes. 
6 0
3 years ago
1. Janica placed an ice cube in her thermos of hot coffee. Which of the following
Simora [160]
A because heat is a form of energy and the coffee is heating up the ice cube and it is not D because it is not releasing any byproducts when the ice cube is melted
6 0
3 years ago
Read 2 more answers
If glucose is absent, but so is lactose, the lac operon will be ________.
umka2103 [35]

Answer:

Activated

Explanation:

In the presence of lactose, and in the absence of glucose, lactose will bind to a protein called a "repressor," deactivating it. Through this, RNA polymerase has a free way to synthesize the mRNA that will give enzymes for lactose degradation.

7 0
3 years ago
Read 2 more answers
What was rudolf virchow trying to prove through his work?
geniusboy [140]
( C ) -That the spontaneous generation doesn’t happen
8 0
4 years ago
What cell organelle is responsible for breaking down sugar to produce energy? mitochondria golgi complex nucleus ribosome
vichka [17]
The mitochondria is responsible for breaking down sugar to produce energy.
6 0
3 years ago
Read 2 more answers
Other questions:
  • An idea that has been repeatedly tested and becomes widely accepted is what?
    14·1 answer
  • While the earth is home to many members of this phylum earthworms are not a member of blank
    12·2 answers
  • How does the nucleus controls cell? Be specific
    5·1 answer
  • This bonds to guanine (G) in DNA.
    13·2 answers
  • An apple falls off a tree onto the ground. Which of the following best describes what eventually happens to the material that ma
    14·1 answer
  • What does atomic number for an element represent ?
    7·2 answers
  • What are some negatives and some positives of coastal development?
    5·1 answer
  • Select the best answer for the question
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Please help me answer this
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!