1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gulaghasi [49]
3 years ago
6

________ is (are. not important as a stimulus in the gastric phase of gastric secretion.

Biology
1 answer:
Anon25 [30]3 years ago
3 0
Carbohydrates are not important as a stimulus in the gastric phase of gastric secretion, whereas distension, peptides, and low acidity are.
You might be interested in
Two pods of dolphins (same species) exist off the coast of Mexico. Pod A likes to swim and play at depth in cooler water. Pod B
stellarik [79]

Answer:

The correct answer is - speciation is sympatric.

Explanation:

Sympatric speciation is a process of speciation that takes place when there is reproductive isolation between two populations of a species without any geographical separation.

This speciation takes place in the population with come ancestors as given in the question both pods of dolphins lose their ability to interbreed due to the sympatric speciation without any geographical separation.

Thus, the correct answer is - speciation is sympatric.

3 0
2 years ago
Which change of state of water releases heat energy?
Anna35 [415]
The gas state. When water boils, it releases a gas we know as steam.
3 0
3 years ago
A source from which organisms generally take elements is called
Anit [1.1K]

Answer:

A source from which organisms generally take elements is called exchange pool (option B).

Explanation:

Options for this question are:

  • <em>Food web.</em>
  • <em>Exchange pool.</em>
  • <em>Reservoir.</em>
  • <em>Biotic community.</em>

The term exchange pool is related to the biogeochemical cycles that exist in nature, referring to the source from which elements present in the environment become part of living organisms.

<u>Exchange pools are the biotic components</u> -like animals and plants- of an ecosystem, which determine the passage of elements between living beings. An element can remain as a reservoir (abiotic) in the soil, and then be incorporated into the exchange pool.

4 0
3 years ago
This element can form a wide variety of substances, including long chains. The different substances it forms are central to the
Studentka2010 [4]

Answer:

The element is carbon

Explanation:

It has ability to catenate and it is a major constituent of all living matters

5 0
3 years ago
How many pairs of legs do insects have? five four three
-BARSIC- [3]

Answer:

a spider has 4 pairs of legs, since they have 8 legs

5 0
2 years ago
Other questions:
  • In an ecological pyramid what happens to energy biomass a number species as you move up
    11·1 answer
  • How are the animals in a desert ecosystem most likely to differ from the animals in a rain forest ecosystem?
    9·1 answer
  • How does a nail become a magnet when it is placed in a strong magnetic field?
    12·1 answer
  • How does a shield volcano form?
    7·1 answer
  • Which of the following applies to hyaluronidase?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • After the experiment,scientists organize and _the data?
    14·1 answer
  • Explain how the sense of smell works on a molecular level. Be sure to describe what is happening in the brain as well?
    9·1 answer
  • Which of the following is NOT an example of radiant energy?
    15·2 answers
  • What features of integrated pest management make it a good approach to preserving ecosystems?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!