Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
The answer is B, extensive research of an individual organism over many years.
Explanation:
The question is asking, what best describes Darwin's studies that led to the theory of evolution, it would be a lot of research over a long period of time. Think, if you were to do a school project, would you get your best results over a short or long period of time with little or a lot of evidence/research? So, B is the best answer, I believe.
(PLEASE BRAINLIEST)
Answer:
study the material at home at a pace that suits your learning needs.
regroup in the classroom for discussions and hands-on workshops. Teachers mentors students.
further your knowledge back at home with all the insights from their class/group discussions.
Answer: They may be prokaryotic is false.
Explanation:
Protists are eukaryotic organisms i.e they have membrane bound organelles and Nucleus. They are neither plants,animals or fungus. Protists have many form of nutrition and they may be aerobic or anaerobic.
Some protists photosynthesized like algae while others are heterotrophs
They may be unicellular or multicellular.
Some protists have cell walls while others don't.
