1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ki77a [65]
3 years ago
13

hey i need one of yall to please answer this question for science pls! Explain how the components of the mouth start digestion.

thanks for the help
Biology
1 answer:
quester [9]3 years ago
5 0
The saliva has enzymes that start to break down food using the lock and key system.The teeth chews the food and begins mechanical break down of food
You might be interested in
Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon dioxide and water. Two sampl
aksik [14]

Answer:

For sample A, A=17.7 %, T=17.7 %, G=32.30%, C=32.30%

For sample B, A= 28.9%, T=28.9%, G= 21.10%, C= 21.10%

Explanation:

The composition of nitrogenous bases in DNA is calculated using the suggestions proposed by the results of the experiment performed by Erwin Chargaff.

He found that in a DNA sample the composition of purine to pyrimidine is 1:1. This indicates that the amount of purine equals pyrimidine. This can be presented as purines + pyrimidines= 100. Also, adenine binds thymine and cytosine binds guanine.

In the given question,  

<u>For sample A </u>

A= 17.7 %, Therefore, thymine will be = 17.7 %,

A+T= 35.40%

Now, G+C=100- 35.40%

G+C= 64.60%

content of G= 64.60/2= 32.30%

content of C= 32.30%

<u>For sample B </u>

T=28.9%, A will be= 28.9%

A+T= 57.80%

G+C=100-57.80%

G+C= 42.20%

Thus content of G will be= 42.20/2=21.10

content of C= 21.10%

Thus,  

For sample A, A=17.7 %, T=17.7 %, G=32.30%, C=32.30%

For sample B, A= 28.9%, T=28.9%, G= 21.10%, C= 21.10%

6 0
3 years ago
Why are fungi unable to live in dry areas?
mezya [45]
They can’t live in dry areas because fungi need to be able to trap moisture since their broad tops can dry out
3 0
3 years ago
Read 2 more answers
When colorblind women married a male with normal vision, all their daughters have normal vision and all their sons are colorblin
worty [1.4K]

Answer:

X-linked recessive

Explanation:

The trait is a sex-linked trait because the daughters are not colorblind, but the sons are. We know this its recessive because the daughters have inherited the mother's X chromosome that has the colourblindness trait, but are not colorblind because the father's X does not have the colourblindness trait. The sons are colourblind because they inherited the X from their mother with the colourblindnese trait and a Y from their father. The colourblindness trait or normal vision trait is not carried on the Y, so the mother's X chromosome's trait is expressed.

Sorry if it's confusing i tried my best to explain it

8 0
2 years ago
What process is similar to cellular respiration?
astra-53 [7]

Answer:

Fermentation

Explanation:

they are basically the same process, but slightly different in some ways

8 0
3 years ago
What is a non-native species?
Lapatulllka [165]

Answer:

on-native species can become such a common part of an environment, culture, and even diet that little thought is given to their geographic origin. For example, soybeans, kiwi fruit, wheat, honey bees, and all livestock except the American bison and the turkey are non-native species to North America.

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • A patient is 32 years old and complains of chest pain, a burning sensation in the chest, increased salivation, and difficulty sw
    15·1 answer
  • Approximately 50 percent of every protein molecule is composed of nitrogen. T/F
    12·1 answer
  • Population growth is:
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is normally present in urine? How does the filtration barrier function to prevent things from entering the filtrate? What d
    7·1 answer
  • Identify the indentation that is inferiorolateral to the auricular surface. Identify the indentation that is inferiorolateral to
    10·1 answer
  • Down syndrome in humans may result from. A a person inheriting a recessive allele. B sickle-shaped cells becoming stuck in blood
    15·1 answer
  • There are some phylum including
    6·1 answer
  • How would decreasing the amount of water in blood affect blood pressure
    10·2 answers
  • How to determine the inputs and outputs of carbon dioxide in the atmosphere.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!