1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alina1380 [7]
3 years ago
11

based on the results of this study what question remains unanswered how can these questions guide future research​

Biology
1 answer:
qwelly [4]3 years ago
5 0

Answer:

One of the biggest questions is, Can we replicate these results in other plants? So, there needs to be more research to determine whether this technique is effective in food crops. It’s not known what the protein PsbS does, even though it seemed to enhance plant growth. There should definitely be more research to find out how this protein is linked to plant growth and whether boosting this protein will affect growth in other types of plants. The researchers also noted that there are numerous other ways to make photosynthesis, and there are more than 100 chemical reactions involved in the process. Investigating other possibilities might be the key to improving crop yield in a wide variety of crops.

You might be interested in
A slow-moving stream has many plants growing in it. changes to the climate makes the water in the strem move much faster. what i
Neporo4naja [7]

Answer:

B. the stream will have fewer plants growing.

Explanation:

6 0
2 years ago
What would occur if cells were in mitosis more than they were in interphase?
steposvetlana [31]
Mitosis is the cell division process that occurs anywhere in the body, these except the production of the gametes. 
If the cells were more in the mitotic process then the cells would only keep dividing in an amassing rate. This might cause some genetic errors and dysfunctions. 
6 0
3 years ago
Which of the following is not an example of an organism responding to a stimulus
zalisa [80]
Stimulus is the light on a insect and moves towards the light . If the insect doesn’t respond to the bright light then you know that the light is not a stimulant figure for the insects to respond to
4 0
3 years ago
Which of the following protist groups correctly completes the sentence below?
Schach [20]

Amoeba are the consumers that surround, engulf, and ingest their food.

<h3><u>Explanation</u>:</h3>

Amoeba is a unicellular organism that belongs to the kingdom Protista. This organism are having eukaryotic cells without any cell walls. These organisms have each and every cellular organelle that are needed to perform metabolism.

Amoeba are consumer in mode of nutrition. Whenever they senses some food, they push a part of their cytoplasm packed in cell membrane towards the food to cover it. This process is called pseupodia.

This pseupodia engulfs the food and performs phagocytosis or pinocytosis. This food is covered in a cell membrane inside the cytoplasm which is called the food vacoule or endosome. This then fuses with a lysosome to digest and then the excretory product is let off by the secondary vacoule.

8 0
3 years ago
Read 2 more answers
What is Automatic on my face I love the picture o-Brewery Syndrome?
Pavlova-9 [17]
Girl what the hell are u on
4 0
3 years ago
Read 2 more answers
Other questions:
  • When a parent cell makes several nuclei and divides to make several daughter cells, it is called _____.
    9·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How have Asian giant hornets been useful/good for humans (in Japan)?<br> ASAP!!
    12·1 answer
  • Beatrice has a daisy. She doesn't want the daisy to become fertilized. What should she do to prevent the daisy from fertilizing
    11·2 answers
  • Several medicines that treat human diseases have been sourced from plants in tropical rainforests. For example, quinine, which i
    15·2 answers
  • Glucose, a carbohydrate, readily dissolves in your bloodstream. cholesterol and triglycerides—both lipids—are packaged inside th
    5·1 answer
  • The region known as the macula densa is part of
    6·1 answer
  • Because the imaginary axis of the earth is inclined to the sun at the equator, the northern and southern hemispheres shine in di
    12·1 answer
  • Organisms obtain energy by breaking down food during a chemical reaction. Which substance reacts with the food in the chemical r
    15·2 answers
  • What would happen to a cell if there was no endoplasmic reticulum? Please help ;-;
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!