Ask question

Ask question

All categories

3 years ago

5

Every hiv particle contains two rna molecules. if two genes from one rna molecule become detached and then, as a unit, get attac

hed to one end of the other rna molecule within a single hiv particle, which of these is true

1 answer:

myrzilka [38]3 years ago

7 0

Maybe, not sure, may need to check yahoo answers for this one

You might be interested in

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0

3 years ago

When assessing temperature of the skin, which portion of your hand should be used?

yanalaym [24]

B.) Ulnar aspect of the hand

5 0

3 years ago

Reproductive system brain pop Worksheet<br><br> Help please?

faltersainse [42]

Their is the answer

5 0

2 years ago

Which is an example of a population?

JulijaS [17]

Well lets see here, The definition of population is a particular section, group, or type of people or animals living in an area or country. So it would be D.<span>
</span>

5 0

3 years ago

Compare and contrast the terms phenotype and genotype

RoseWind [281]

Phenotypes are the way the animal looks, the Genotypes are the the genetic makeup: like BB or Bb or bb

3 0

2 years ago