1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina86 [1]
4 years ago
5

Provide evidence to reject this statement, "Human phenotypes are usually a clear cut either situation"

Biology
2 answers:
tensa zangetsu [6.8K]4 years ago
8 0
Wavy hair is a very easy example that this is false.  It's a merge between straight and curly hair.  Our traits tend to mix and blend together, it's not so simple.  Everybody isn't just tall or short, one or the other.  Everybody is a different height because it's a mid between your parents. 
densk [106]4 years ago
3 0
The traits of father and mother are normally the characteristics found in offsprings for example ear lobes attached of free.
You might be interested in
For a project I needed to ask 25 people : do you think eating meat is bad for the environment?
Lelu [443]

Answer:

Yes (It's more inefficient)

Explanation:

in ecology there are things called primary producers (plants) that are eaten by primary consumers (cows and chickens) and then there are humans, secondary consumers, that eat cows and chickens for energy.

The further we move from eating primary producers the more inefficient we become in consuming energy. Meaning, it requires a lot more natural energy consumption to support a human that lives on meat only as compared to a human that eats plants only. this inefficiency only magnifies when communities practice unsustainable food methods.

There are sustainable ways to eat meat, but (at least in the US) our current conventions of meat production are unsustainable and environmentally destructive.

5 0
3 years ago
Darwin and wallace's theory of evolution by natural selection was revolutionary because it _____.
Lisa [10]
<span>Notice a couple of things different between (A) and (B). It was NOT the first time a biologist proposed that species changed through time (so it's not B). But it finally *solidified* that idea by giving "change through time" (evolution) a MECHANISM. It gave a plausible explanation for WHY species change over time, in a testable way that made sense and had evidence to support it.

So it finally dismissed the idea that species are constant.

It also emphasized that the simple presence of *variation* within a population was a key reason for evolution.

While we're at it ... (C) is wrong because it's not *individuals* that acclimate (adapt) to their environment, but the population (the species) as a whole.

And (D) is wrong because it had nothing to do with economics or the monarchy.</span>
5 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Which of these characteristics BEST describes a difference between eukaryotic and prokaryotic cells?
kumpel [21]

Answer: c

Explanation:

4 0
3 years ago
What happens to the temperature when the atmospheric co2 level increases in this model?
Arada [10]

Answer:

The temperature of the surrounding air increases when the atmospheric CO2 level increases.

Explanation: Carbondioxide gas is a very important gas in the environment but high amount of it cause damage to the organisms.

Carbondioxide gas is also called greenhouse gas because it has the ability to absorb or trap heat energy when the solar radiation goes into the space after hitting the earth surface. If the concentration of carbondioxide gas is increased, more heat energy will be trapped and thus increase occurs in the temperature of the atmosphere which results in global warming.

4 0
3 years ago
Other questions:
  • Which process drives Darwin's theory of evolution?
    11·1 answer
  • How would bark on a tree compare to our respiratory system?
    7·1 answer
  • What determines whether a person will have dimples or not?
    5·2 answers
  • The process of the moon beginning to illuminate from a new moon to the full moon, appearing larger, is called-------------
    13·1 answer
  • The cells size does not affect the rate of diffusion but in large cells materials have to travel further to reach the middle of
    13·1 answer
  • Under normal conditions, glomerular filtration depends on three main pressures. From the list below, what are these three main p
    6·1 answer
  • Genetic Variation and Evolution Quick Check
    5·1 answer
  • Will the sun eventually become a neutron star?
    15·1 answer
  • Which of The following substances below is match with its correct organic group: A)monosaccharides- nucleic acids B) DNA-lipids
    5·1 answer
  • Which statement accurately describes a relationship between two parts of the universe?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!