The plant belongs to the group Angiosperm. Vascular plants with seeds could be cycads, Gingko, conifers, or angiosperms. Among those groups, only angiosperms have flowers.
The plant they found have colored, scented flowers which suggests that it could be pollinated by insects or birds. Colored flowers attract birds and insects. Color serves as a guiding mark. Talking of scent, it does not attract bird, but attracts insects. It also serves as the guiding mark.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The answer for the above question is Mutation.
Mutations are random spontaneous changes that occur suddenly in the DNA. A single mutation can have a large effect, however in may cases evolutionary changes are based on the accumulation of many mutations. The gene flow is any movement of genes from one generation to another and is an important source of mutation
Example of habitat degredation
Decomposer's role is to break down dead food. They basically eat it, then the dead food or the dead animal gets ground into the ground, and makes the soil good. Like worms, or fungi, mushrooms, etc. Rotten fruit is not really wasted because 1) the decomposers eat it, and 2) it makes the soil good
