1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ololo11 [35]
3 years ago
12

A student sets up an experiment according to the date table below.Based on the table,which question was the student most likely

investigating ?
Biology
1 answer:
Vera_Pavlovna [14]3 years ago
3 0

Answer:

Which is faster, visual or auditory reaction times?

You might be interested in
All the iron molecules that are in your body were originally created by
Alenkinab [10]
ANSWER
D. a star hope this helps :)
5 0
3 years ago
Describe how physical and chemical changes affect mass
AlladinOne [14]

Answer:

Explanation:

Matter can change form through physical and chemical changes, but through any of these changes matter is conserved. The same amount of matter exists before and after the change—none is created or destroyed. This concept is called the Law of Conservation of Mass.

5 0
2 years ago
Which plate is moving below the Pacific plate?
KiRa [710]

Answer:

The Pacific Plate is moving to the northwest at a speed of between 7 and 11 centimeters (cm) or ~3-4 inches a year. The North American plate is moving to the west-southwest at about 2.3 cm (~1 inch) per year driven by the spreading center that created the Atlantic Ocean, the Mid Atlantic Ridge.

Explanation:hope it works for you:)

8 0
3 years ago
1. List the producers in this food web.
Vinvika [58]
1. The producers in this food web are the tree, plant, and bush in the bottom right.

2. The primary consumers are the giraffe, rhino, bug, mouse, and deer.

3. Three secondary consumers are the bird, fox, and monkey.

4. Three tertiary consumers the skunk and whatever that thing is between the monkey and fox (the image is blurry).

5. Two quaternary consumers are the vulture and the monkey.
6 0
3 years ago
During what part of the water cycle does a liquid turn into a gas
Nikolay [14]
That part of the water cycle is called condensation....
3 0
3 years ago
Other questions:
  • What type of mutation causes cystic fibrosis?
    6·1 answer
  • Multiple Alleles are caused by what? A) Mutation B) incomplete dominance c) recessive genes d) none of the above
    5·1 answer
  • DNA replication occurs prior to meiosis and _________.
    14·2 answers
  • stating that an organism is heterozygous is staying its ..... a. genotype... b. phenotype.....c. karyotype....d. test cross
    12·2 answers
  • The situation in which some individuals have greater reproductive success than other individuals in a population. Along with var
    8·1 answer
  • Which is the function of the enzyme DNA polymerase during replication?
    13·1 answer
  • Describe the energy transformation when a match burns.
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Why is herbivores insect is least common?
    13·1 answer
  • Substance A is added to water. After it is added, hydrogen ions are produced and accumulate in the solution. Most of the hydroge
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!