1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
15

3. Centrosomes are present only in

Biology
1 answer:
denis-greek [22]3 years ago
5 0
Answer es b animal cells porque es estupendo
You might be interested in
Data about our past climates is contained in...
ipn [44]

D. ice core samples for the arctic and anarctic

6 0
3 years ago
Read 2 more answers
7) 4 unique haploid daughter cells are formed:
Anettt [7]

Answer:

Meiosis II

Telophase II

Explanation:

The chromosomes line up in a similar way to the metaphase stage of mitosis. The sister chromatids separate and move toward opposite ends of the cell. Meiosis II results in four haploid (N) daughter cells. You have FOUR (4) daughter cells with the haploid number (N) of chromosomes

6 0
4 years ago
What is the best explanation if the gel of your PCR product shows smeared bands of multiple sizes? Select one:
trapecia [35]

Answer:

e. None of the above

Explanation:

For me as a Researcher, the reason could be increased Concentration of your DNA sample which you are using as your template. Try to decrease the concentration of DNA (up to 100 ng per reaction is enough and can increase up to 200 ng). so the reason for getting non specific bands is increase concentration of DNA  which results in non specific amplification and also degradation of DNA in the reaction which you can see in your gel electrophoresis results.  

i always corrected my results using the same technique that is lowering the concentration of DNA between 100 and 200 ng per single reaction of PCR.

8 0
3 years ago
If an organism uses mitosis (asexual reproduction) to reproduce. What is the outcome?
EastWind [94]

Answer:

B

Explanation:

I learned this 2 years ago

6 0
3 years ago
Read 2 more answers
Identify the benefits to native species of joining similar habitats with corridors
egoroff_w [7]
The benefits were more species and also more resources.<span />
5 0
4 years ago
Other questions:
  • Why the location and quality of food sources in the soil are sometimes likely to stimulate random movements by C. Elegans, but a
    13·1 answer
  • Jessica travels to a remote village in the Amazon jungle in order to work as a medical volunteer. While in this village, Jessica
    8·2 answers
  • What is the relationship between the two parts of the nervous system? (2 points the peripheral nervous system transfers impulses
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which of the following would be considered a benefit of overproduction?
    12·2 answers
  • intracytoplasmic iron ganuakes can be seen as anither distinct morphologic appearance of copper deficiency true or false​
    8·1 answer
  • Uncontrolled cell growth would most likely be attributed to what
    13·1 answer
  • Kjdxnjkshicohjdioshco ijdsiochoidshovchdohcoidshiochoixhcoihoxhi oxzhioih ioxho ihzoxh ozhxio hozh
    7·2 answers
  • Glucose molecules are to starch as ________ are to proteins.
    15·1 answer
  • The two systems that work together to cause this reaction are the endocrine system that secretes the hormone and the
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!