1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tom [10]
3 years ago
11

True or false: oxygen and glucose are produced by photosynthesis and consumed in cellular respiration.

Biology
1 answer:
VLD [36.1K]3 years ago
7 0
This is true they are the products of photosynthesis and the reactants for aerobic respiration. 
You might be interested in
Chose all that apply for spring tides
AURORKA [14]

Answer:

lol

Explanation:

I don't know good luck

5 0
3 years ago
Read 2 more answers
What is the difference between accurate data and reproducible data?
Nimfa-mama [501]
I know accurate is really close or exact but the reproducible ive never heard
5 0
2 years ago
Read 2 more answers
Perhaps the single greatest contribution Linnaeus made to science was his method of naming species. This method, called binomial
ehidna [41]

Answer:

Binomial nomenclature is the naming system developed by Carolus Linnaeus. In this system, latin language was used because it is a dead language which cannot be spoken by people in the world. In binomial nomenclature, two names are used. One for genus and the second for specie. For example, Rana tigrina is the scientific name of frog. In this name rana is genus and tigrina is specie.

9 0
2 years ago
Which of these biomes tends to receive the most rainfall?
GaryK [48]

Answer:

O B. Rain forest

Explanation:

5 0
3 years ago
Anyone please inbox me​
sashaice [31]

Answer: Why?

Explanation: I hope you are okay.

4 0
2 years ago
Read 2 more answers
Other questions:
  • One effect of decreasing wolf populations in north america is:
    10·1 answer
  • An increase in Earth’s average temperature due to the buildup of carbon dioxide and other gases in Earth's atmosphere is called
    5·1 answer
  • Who catalogued rocks and minerals around 200bce
    7·1 answer
  • How is the Endoplasmic Reticulum like a factory line?
    9·1 answer
  • Which 2 subatomic particles are located in the nucleus?
    11·2 answers
  • Harry notices that one of his houseplants does not grow very well compared to his other houseplants. He asks himself “What is di
    12·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What<br> are<br> control variables ?<br> ?
    11·2 answers
  • 1. Which of the following structures are not homologous?
    7·1 answer
  • How can we use the Doppler Effect to locate galaxies in space?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!