1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astraxan [27]
4 years ago
12

A client is diagnosed with systemic lupus erythematosus. which assessment data support this diagnosis? (select all that apply.)

Biology
1 answer:
olchik [2.2K]4 years ago
7 0
The options attached to the question above are given below:

A.African American female

<span> <span>B. </span>Contractures of the fingers <span> <span>C. </span>Facial butterfly rash noted D.Swelling and pain in knees <span> <span>E.  </span>Pain worsens in the eveningANSWERSThe following statements apply"1. African American female.2. Contracture of the fingers/3. Facial butterfly rash noted.4.Swelling and pain in the knees.The disease is common in African American female. The contracture of fingers is a classic symptoms of the disease and facial butterfly symptom occur in about 40% of the patients. The pain of the disease usually get worse in the morning.   <span> </span></span></span></span>
You might be interested in
What are brown bears doing as a result of panting
Elden [556K]
The 4th one. Maintaining body temperature and cooling down
6 0
3 years ago
Read 2 more answers
Energy released from the cellular respiration of glucose is
barxatty [35]
ATP molecules
Ig that what the question meant
6 0
3 years ago
Using a water bottle as our topic, describe how changing the type of water bottle fits into the four areas of sustainability; en
Masja [62]

Answer:

The world needs to stop the use of Plastic Water bottles.

Because plastic is non-biodegradable, it pollutes the environment, the rivers, drainage systems, and even our oceans.

Plastic Water Bottles have become a bio-hazard to our marine ecosystem. Autopsies performed on some sea fish have revealed several kilograms of human waste comprising mostly of plastic.

Another reason why it is critical to commence the disuse of the plastic water bottle is that it is not sustainable. Plastic is made from resins. Resins are gotten from plants and trees. It is impossible to continue to harvest resins at the current rate of plastic production and still have a green earth.

In some countries, purchasing water in a plastic bottle is a status symbol. The politicians who need to make decisions with regard to these issues are not helping matters because many of them either are not concerned or have vested interests in the companies along the value chain of plastic water bottle production.

Economically speaking, discontinuing the production of plastic water bottle may hurt quite a few companies. However, the government can help them transition into the production of other types of bottles such as stainless steel or glass water bottles which have less hazardous effects on the environment.

Cheers!

4 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Newton's first law of motion states that an object at rest, stays at rest, even if an
Natasha_Volkova [10]

Answer:

True

Explanation:

Newton’s First law of Motion states that an object in motion will stay in motion and an object at rest will stay at rest unless acted upon by an unbalanced force.

7 0
4 years ago
Read 2 more answers
Other questions:
  • What benefits are associated with Magic Johnson's announcement concerning his HIV-positive status? What risks or drawbacks can y
    5·1 answer
  • Which two atoms form covalent bond?
    7·2 answers
  • The place or type of ecosystem in which a species lives and obtains what it needs to survive
    8·1 answer
  • During which part of the scientific method would error bars be used?
    13·2 answers
  • Which of the following would be an individual effort to reduce air pollution? the Clean Air Act of 1970 building a carpool lane
    14·2 answers
  • How does a circular template stop replication a. A polymerase falls off at the correct time, different polymerases last differen
    13·1 answer
  • Which scientist devised tests that helped confirm that bacteria and other microorganisms cause a variety of diseases?
    12·1 answer
  • Is potassium a mineral and an electrolyte?
    15·2 answers
  • Help it’s a test giving brainleist and like please fast
    13·1 answer
  • 18. Steve is making a model for geology class, showing how rocka form. He is
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!