To keep the body's internal environment in balance c) to make room for nutrients coming in d) to reduce unpleasant
Answer:
The answer would be A it connects the endocrine and nervous systems and controls the pituitary gland.
Hope this helped, Really need that brainliest
*Befri.stends
Explanation:
Google your question. then click the videos option. and click the first video below.
Gluteus maximus ............
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
