1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna [14]
3 years ago
7

The DNA oligonucleotide abbreviated pATCGAC________________.

Biology
2 answers:
Vikentia [17]3 years ago
5 0

Answer:

The answer is B

Explanation:

has a hydroxyl group at its 3' end.

morpeh [17]3 years ago
3 0

Answer:

Correct answer is (B) has a hydroxyl at its 3' end.

You might be interested in
7) True or False: All plants need the same amount of sun<br> to make enough food to be healthy.
timama [110]

False, many plants are sensitive to sunlight depending on the plant

5 0
3 years ago
Why is the cell membrane said to be selectively permeable
Rudiy27

The cell membrane is said to be selectively permeable is because it allows a select few things to go through while stopping the passage of other stuff.

4 0
3 years ago
Why do areas of lower pressure usually experience stormy weather
alina1380 [7]
The air begins to rise into the atmosphere. When air rises, it cools down and condenses into precipitation and clouds. This is why an approaching low pressure system means an increased chance for clouds, rain, or snow. It is called "low pressure" because as air rises, the air pressure is lower at the surface.
3 0
3 years ago
About 10% of all alcohol eliminated by the body comes from?
Marina86 [1]
The correct answer is lungs, kidneys, and perspiration. About 10% of all alcohol that you have intaken is being eliminated by the body come from the lungs, kidneys, and perspiration. Through lungs, it eliminates it through respiration. In kidneys, alcohol is being excreted through urination and for the perspiration is excreting alcohol content through sweating.
8 0
3 years ago
Read 2 more answers
20 POINTS!
Flauer [41]

Answer:

fals tru true

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Explain how each of the five types of prewriting assist a writer in getting started. please make it short.
    11·1 answer
  • Identify the errors in the image. The egg stage is missing. The mosquito transforms into a butterfly. The pupal stage should com
    7·2 answers
  • In rosebushes, chlorophyll is responsible for the process of photosynthesis. chlorophyll is located in
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The g1 phase of the cell cycle is characterized by
    7·1 answer
  • How does interphase prepare a cell to divivde?
    9·1 answer
  • Do you get all the energy from a piece of fruit you eat?
    8·2 answers
  • The volume of a right circular cylinder can be approximated as follows: Volume = ?r2h; where r is the radius of the cylinder and
    14·1 answer
  • Help Please!!
    15·1 answer
  • What are the resources/factors that all organisms compete for in their environment?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!