1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aliun [14]
3 years ago
9

An endoskeleton made up of hard plates beneath the skin is a characteristic of the _______________ phylum.

Biology
1 answer:
Umnica [9.8K]3 years ago
6 0
An endoskeleton made up of hard plates beneath the skin is a characteristic of the echinodermata phylum. Organisms under the phylum echinodermata have tight interlocking plates that form their endoskeleton. Sea urchins, starfishes and sea cucumbers are examples of echinoderms. 
You might be interested in
How humans activeity affects earth natural resouses
earnstyle [38]
Because of the severe impact that we impose on the land, air, and water, conservation has
become increasingly important.
 Conservation is using natural resources wisely and not contributing to pollution of the land, air or water. Human activities can benefit the environment and help preserve resources.
 Conservation can include small-scale clean-up projects along roadways or building fences to prevent dune erosion to large-scale beach renourishment. Planting trees is another way to support conservation as trees are too often removed without being replanted.
 The phrase “Reduce, Reuse, and Recycle” has been a catch phrase of the late 20th and early 21st centuries.
3 0
3 years ago
“If _______ changes, then the amount of transpiration will ______ because_______.”
yaroslaw [1]

Answer:

Whats the question?

Explanation:

3 0
4 years ago
As a piece of linear dna is replicated, the leading strand will have _____ rna primer(s) and the lagging strand will have _____
EastWind [94]
1.will have one 2.will have many
3 0
3 years ago
Hugh is writing an article for an ecological magazine. Help him complete the sentences
stiv31 [10]

Answer:

answer 1: efficiency

answer 2: lower

Explanation:

hope that helps

4 0
3 years ago
What is the maximum number of hours that good can be held in the danger zone?
Serggg [28]
3 hours because it dangerous
3 0
3 years ago
Other questions:
  • Como nos es útil el microscopio en la vida cotidiana ?
    11·2 answers
  • Organelles and other cellular material are held within a cell by which of the following?
    6·1 answer
  • Which type of diversity refers to the amount of variation in the gene pool of a species
    5·1 answer
  • When plates slide past each other, the edges of these plate blank zones
    11·2 answers
  • Contrast the reproduction of bacteria with that of frogs
    12·1 answer
  • If short hair (L) is dominant to long hair (l), then what fraction of the offspring produced by a cross of Ll x ll will have lon
    14·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • List the two types of viral reproduction and describe their differences. Make sure to note which one is immediately harmful to t
    6·1 answer
  • The Role of Minerals in Healthy Bone Tissue and Osteoporosis Risk
    8·1 answer
  • What are the differences you can see when you compare the nucleons of a dividing cell with that of a non dividing cell
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!