1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pshichka [43]
3 years ago
9

Which of the following adaptations helps alpine animals survive the cold winters

Biology
1 answer:
Komok [63]3 years ago
3 0
The alpine animals hibernate, migrate to warmer regions, and have thick layers of fur and coat which help them from cold winters. 
You might be interested in
Can you cry underwater?
garri49 [273]
Yes you can cry underwater but you would most likely drown because when you cry, you breathe heavily and trying to breath underwater? lol nah
3 0
3 years ago
A plate moves 200 m in 10,000 years. What is its rate in cm/year?
schepotkina [342]

Answer:

1m = 100cm

200m = 20000cm

10,000years = 20,000cm

1 year = 20,000/10,000

= 2cm

It's rate is 2cm/year

The answer is option b.

Hope this helps.

6 0
3 years ago
A microscope technique that will not allow one to see specific parts of living specimen is
Svetlanka [38]
C using a scanning electron microscope
6 0
3 years ago
The deep palmar veins drain into the radial and ulnar veins; then those veins, along with the anterior crural interosseous vein,
galina1969 [7]

Answer:

Brachial vein.

Explanation:

Veins may be defined as the blood vessels that carries the blood towards the heart. The main function of the vein is to carry the deoxygenated blood into the heart.

Brachial vein is the deep veins that has the name as their arteries occupy. The brachial veins receive their blood from the palmar veins with the interosseous vein. The brachial veins include the ulnar vein, radial vein in upper limb and lower limb consists of popliteal veins.

Thus, the answer is brachial veins.

3 0
3 years ago
Tissue engineering either replaces with synthetic materials or combines living cells with synthetic materials to create function
wlad13 [49]

Answer: epithelial

Explanation:

6 0
4 years ago
Other questions:
  • What is a carbohydrates
    13·2 answers
  • Which of the following is a valid scientific argument? Group of answer choices Measurements of sea level on the Gulf Coast taken
    6·1 answer
  • What is the maximum magnification of a compound light microscope? 500x 1,000x 2,500x 5,000x
    14·2 answers
  • How does the plant get all of the reactants needed for photosynthesis?
    8·1 answer
  • Name at least 4 other scientists who influenced darwin’s theory.
    15·2 answers
  • A ________ diet restricts or eliminates foods that are hard to chew and swallow.
    7·1 answer
  • Why do mosses grow well in the Arctic tundra?
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The repeated movement of certain substances between organisms and the atmosphere is called a(n)
    9·1 answer
  • What can increase the rate that lactic acid is removed from the muscles?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!