1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marshall27 [118]
3 years ago
10

Why would breathing faster and having your heart beat faster when you exercise help your body to do MRS GREN?

Biology
1 answer:
MrRissso [65]3 years ago
8 0
Because you are getting your blood moving I’m you body and it’s like generating your body
You might be interested in
Cytopathic effects are changes in host cells due to.
anzhelika [568]

Answer: viral invasion.

Explanation:Cytopathic effect or cytopathogenic effect (abbreviated CPE) refers to structural changes in host cells that are caused by viral invasion. The infecting virus causes lysis of the host cell or when the cell dies without lysis due to an inability to replicate. Both of these effects occur due to CPEs.

4 0
2 years ago
ANSWER PLEASE WILL GIVE BRAINLIEST
nata0808 [166]

Answer:

There all vertabrete

Explanation:

6 0
3 years ago
Which of these statements is NOT a characteristic of the cladistics system? It shows the "rank" of the organism. It shows the pr
Stells [14]
It shows the "rank" of the organism is not a characteristic of the cladistics system. Showing the probable sequence of origins, and showing shared derived characteristics are characteristics of the cladistics system.
6 0
3 years ago
22. Label the organisms in the food web below as producer (P), primary consumer (PC), secondary consumer (SC),
Paul [167]

In the above food web green algae is the producer, periwinkle and microscopic animals are primary consumers; mussel, barnacle, dogwhelk and crab are secondary consumers; dogwhelk and crab comes under tertiary consumer; dogfish is a quaternary consumer.

What is a food web?

It is a natural interconnection of several food chains in a single ecosystem. Each food chain supplies energy and nutrients through the ecosystem. There are four food webs producer, herbivores, carnivores, omnivores and decomposers.

Here green algae comes under autotrophs(prepares their own food), periwinkle and microscopic animals are herbivores(depend on producer); mussel, barnacle, dogwhelk and crab are carnivores(depend on herbivore); dogfish is an omnivore(depends on both producer and carnivore).

Learn more about food web from the link given below:

brainly.com/question/2179?utm_source=android&utm_medium=share&utm_campaign=question

#SPJ9

3 0
11 months ago
Suppose some organisms ferment lactose but can't use citric acid for all their carbon needs. These organisms must be A) Shigella
fiasKO [112]

A . Shigella is the organism

4 0
3 years ago
Other questions:
  • The table above shows five different types of chromosomal abnormalities that can occur during meiosis. They result in either an
    9·1 answer
  • Why is a mushroom considered a heterotroph?
    14·1 answer
  • What disorder is caused by hypersecretion of cortisol from the adrenal cortex?
    9·1 answer
  • What phrase best describes a gene
    9·1 answer
  • Which of the following is not a characteristic of Arthropods that has attributed to their diversity and success?
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Give examples of diseases caused by viruses
    14·2 answers
  • Combined sewage overflow has been linked to eutrophication in ecosystems within NYC, including Jamaica Bay and Coney Island Cree
    6·1 answer
  • How do hypothesize identical twins come about
    5·1 answer
  • How many carriers are on this pedigree?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!