Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer: Baboon, Leopard, Cheetah, Brown and Spotted Hyena, Klipspringer, Springbok, Steenbok, Cape and Bat Eared Fox, Hartmann's Zebra, as well as many insects, reptiles, small mammals and even wild Desert Horses
Explanation:
A nervous system because worms don't have nerves
Autonomic dysreflexia is a syndrome in which there is a sudden onset of excessively high blood pressure. It is more common in people with spinal cord injuries that involve the thoracic nerves of the spine or above (T6 or above).Answer:
Explanation:
Answer:
Chromosomes were first named by cytologists viewing dividing cells through a microscope. The modern definition of a chromosome now includes the function of heredity and the chemical composition. A chromosome is a DNA molecule that carries all or part of the hereditary information of an organism. In eukaryotic cells, the DNA is packaged with proteins in the nucleus, and varies in structure and appearance at different parts of the cell cycle.
Explanation:
Cells reproduce genetically identical copies of themselves by cycles of cell growth and division. The cell cycle diagram on the left shows that a cell division cycle consists of 4 stages:
G1 is the period after cell division, and before the start of DNA replication. Cells grow and monitor their environment to determine whether they should initiate another round of cell division.
S is the period of DNA synthesis, where cells replicate their chromosomes.
G2 is the period between the end of DNA replication and the start of cell division. Cells check to make sure DNA replication has successfully completed, and make any necessary repairs.
M is the actual period of cell division, consisting of prophase, metaphase, anaphase, telophase, and cytokinesis.
