1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fgiga [73]
4 years ago
9

Do all mammals have hair?

Biology
2 answers:
Sati [7]4 years ago
5 0

Answer:

yes

Explanation:

Rus_ich [418]4 years ago
3 0
Yes. Some mammals may have less hair/fur, but all mammals do. It is a defining characteristic of a mammal.
You might be interested in
Purpose of the cell membrane.
Semmy [17]

Answer:

The primary function of the plasma membrane is to protect the cell from its surroundings. Composed of a phospholipid bilayer with embedded proteins, the plasma membrane is selectively permeable to ions and organic molecules and regulates the movement of substances in and out of cells.

Explanation: can u give me 5 stars?

6 0
3 years ago
Read 2 more answers
The type of organism that can transfer the energy of sunlight to sugars and ATP is called an
maria [59]

The answer to you question autotroph

I hope it helps you

4 0
3 years ago
Several species of leopard frogs are common throughout North America, where their ranges overlap. Different species of leopard f
MrMuchimi

the correct answer is A- Reproductive isolation occurred through behavioral isolation

A process of formation of a new species from an existing species is called speciation. New species may formed due to geographical or reproductive barriers which isolates the members of a population of a species to form a new species.

In the given question, speciation in In the leopard frogs occurred due to a particular or specific call given by males to the females. The courtship call lead to reproductive isolation due to change in behavior. Such type of behavioral change will help in recognizing mates of the same species and this will act as a reproductive barrier among the other related species.


4 0
3 years ago
Where do joint capsule receptors send proprioceptive information?
crimeas [40]

TO. YOUR. BRAIN. have a nice day?

8 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • Exploring how indoor air pollutions lead to respiratory problems is an example of using biology to what
    9·1 answer
  • In which of the following settings would sound waves travel the fastest through the air?
    7·1 answer
  • The atmosphere traps a part of the Sun’s heat that is reflected from Earth’s surface. This effect, called the greenhouse effect,
    7·2 answers
  • A client has a hiatal hernia. the client is 5 feet 3 inches tall (163 cm) and weighs 160 pounds (72.6 kg). which information sho
    14·1 answer
  • Chitin is a polysaccharide found in the cell walls of fungi<br> true<br> false
    14·1 answer
  • A secondary consumer eats
    12·1 answer
  • A weightlifter who practices five hours a day observes that his muscles have gotten larger. he tells you that his muscle cells a
    11·1 answer
  • Which one of the following comes from the latin word for “honey,” which refers to the spilling of sugar into the urine by diabet
    7·2 answers
  • Many songbirds breed in North America in the spring and summer and then migrate to Central and South America in the fall. They s
    9·1 answer
  • The hemoglobin of sickle cell anemia:
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!