1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artemon [7]
4 years ago
13

When the atoms involved in a covalent bond have the same electronegativity what type of bond results

Biology
1 answer:
slavikrds [6]4 years ago
3 0
The answer is a Nonpolar covalent bond. Hope this Helps:)))
You might be interested in
As liquid water becomes ice, the space between water molecules increases. Which property of water does this change describe?
SCORPION-xisa [38]

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen.

7 0
3 years ago
Read 2 more answers
Compared to plants from other environments, the cells of many desert plants contain high concentrations of solutes. This helps t
Black_prince [1.1K]

Answer:

Low solute potential

Explanation:

There is always a decrease in solute potential when there is increasing or high solute concentration

3 0
4 years ago
Read 2 more answers
What might happen to the organisms in the food web below if the number of phytoplankton and vegetation drastically decreased? Th
cricket20 [7]

Answer: The entire food web

Explanation: Because the small fish eat the plankton and the birds eat the fish, and other things eat the birds etc. etc., technically if the number of phytoplankton and vegetation dropped, it would cause everyone else to have a lack of food

3 0
3 years ago
Read 2 more answers
The combination of natural resources in a forest (air, light, soil, water) determine ______________.
8_murik_8 [283]

Answer:

A.

Explanation:

Group of answer choices

5 0
3 years ago
Several things put together are called
IrinaK [193]
A sedimentary rock is bits of broken up rock
8 0
3 years ago
Other questions:
  • At which plate boundary do earthquakes occur most often?
    14·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • 1. Why did you use a pencil to mark the paper and not a pen? 2. Why do you have to use a different capillary tube for each sampl
    6·1 answer
  • Which of the statements below BEST describes the relationship between chromosomes and genes?
    11·2 answers
  • Why the atmosphere must be studied in order to study winds.
    13·1 answer
  • Which material do humans not rely on soil to help provide?
    5·2 answers
  • Please Help. New Concept. 50 pts.
    8·1 answer
  • And what is the importance of energy efficiency for our daily life
    12·2 answers
  • Name the tissue which makes up the skeleton
    15·2 answers
  • Hi help me please pl​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!