1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Volgvan
4 years ago
15

True or false: "The change from a T to a C at position 3 caused all of the changes that exist between the cichlid and coelacanth

/frog." Explain your answer.
Biology
1 answer:
Crazy boy [7]4 years ago
3 0

Answer:

The above statement is false.

Explanation:

<em>As we can infer from the question, Thymine is being replaced by Cytosine at position 3 of a genetic sequence. This means that only a single change is being made in the genetic sequence. This change will cause a faulty protein to be formed. The faulty protein will be associated with this genetic sequence. </em>

<em>Hence, not all of the changes existing between the cichlid and coelacanth/frog will be associated with this single base change.</em>

However, instead of replacement of C with T, if an addition or deletion of a base might have occurred, then the entire genetic sequence would have been altered causing many changes.

You might be interested in
Given that the rate of DNA synthesis of a plasmid in yeast is 50 nucleotides per second and the circular plasmid replicates in 2
Svet_ta [14]
The answer would be 60,000 bp
6 0
3 years ago
If a non-native species is introduced into an ecosystem and it competes for the same ecological niche as a native species, what
aleksandrvk [35]

The invasive species are the species who are present in a non native ecosystem. The invasion of These species disturbs the environment of particular system by increasing the competition or destroying the vital component of the ecosystem.

The invasive species can increase the competition in the native species, which would lead to the decrease in the number of the native species. There are many species present in the Hawaii department of the agriculture that are endangered, the competition cannot be tolerated here, as it can lead to the extinction of the endangered species present. So, in order to reduce the chance of the extinction due to competition, Hawaii department of Agriculture is very strict about the prevention of the non native or invasive species.

6 0
3 years ago
Read 2 more answers
Skin surfaces that lack hair contain specialized epithelial cells called which are sensitive to touch
nataly862011 [7]
The answer is Merkel cells (Merkel-Ranvier cells<span> or tactile epithelial cells)</span><span>.  They are mostly found in the tips of the fingers, </span>soles, oral, stratum basale of the palms, and genital mucosa, and nail bed,<span> where touch is most sensitive. They are associated with nerve endings</span>




7 0
4 years ago
Predict what would happen if you applied a contaminant to a karst aquifer.
Elanso [62]
The contamint would evaporate
8 0
3 years ago
Read 2 more answers
How is a water shed different from a tributary<br>​
OleMash [197]

A tributary is a freshwaterstream that feeds into a larger stream or river. The larger, or parent, river is called the mainstem. The point where a tributary meets the mainstem is called the confluence. Tributaries, also called affluents, do not flow directly into the ocean.

6 0
3 years ago
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • When blood calcium levels drop, glands embedded in the posterior thyroid secrete ____________ hormone, which stimulates osteocla
    12·1 answer
  • A cell develops into a specific cell type during development; that is, it starts to differ in structure and function from other
    6·1 answer
  • Water soluble molecules often enter or exit a cell in what process?
    14·1 answer
  • How many planets are there in the solar system
    6·2 answers
  • In the late 1980s, however, unusually warm weather caused many of the pools that the toads used as breeding areas to dry up. By
    6·2 answers
  • The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the l
    7·1 answer
  • Based on the diagram above, which organism will have the greatest physical difference from its ancestor?
    8·1 answer
  • Can water speed up the movement of food and waste through the digestive system
    8·2 answers
  • Which trophic level should have the most
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!