1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bezzdna [24]
3 years ago
15

Which equation is compatible 68 divided by 7 35 divided by 9 or 48 divided by 6?

Mathematics
2 answers:
DanielleElmas [232]3 years ago
6 0

Answer: 48 divided by 6

Step-by-step explanation:

48 divided by 6 = 8

crimeas [40]3 years ago
4 0

Answer:

Step-by-step explanation:

48 divided by 6

it is the only one that leaves you with a whole number

You might be interested in
Please help it’s urgent multiple choice
Sergeeva-Olga [200]

Answer:

Theta = 52.1

Step-by-step explanation:

sin theta = opp / hyp

sin theta = 15/19

Take the inverse sin of each side

sin^-1 sin theta = sin^1- (15/19)

theta =52.13635364

To the nearest tenth

Theta = 52.1

7 0
3 years ago
Pls kinda need help <br> lolol
alukav5142 [94]
I think that the answer is A.
3 0
3 years ago
One hamster weighs 300 g less than half
Mars2501 [29]

Answer:

1125&825

Step-by-step explanation:

6 0
3 years ago
Read 2 more answers
the surface of a rectangle is 352mm squared. two of the dimensions are 4 mm 8mm. find the measure of the other dimension​
Nostrana [21]

Answer:

pihrfghb4yysrjrhna4r\h

Step-by-step explanation:

4 0
3 years ago
Write an expression that means the sum of six and the product of three and d
Mrac [35]

Answer:

6 + (3xd)

Step-by-step explanation:

4 0
2 years ago
Other questions:
  • Think about the value of 6 in this number:
    5·1 answer
  • If a line on a distance versus time graph goes back down towards the x-axis, what does that mean
    10·1 answer
  • Factor the four-term polynomial.<br><br> xz + x + yz + y
    12·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 3x + 8x - 2 = 20<br> I need help asap
    10·2 answers
  • A fair spinner has 9 equal sections: 3 red, 4 blue and 2 green.
    12·1 answer
  • Until the scale was changed in 1995, SAT scores were based on a scale set many years ago. For Math scores, the mean under the ol
    5·1 answer
  • I KNOW THIS ISNT MATH BUT PLEASE HELP! Which statements describe the
    5·1 answer
  • How many factors does (2x+5) have
    7·1 answer
  • Gina is comparing the membership fees for two museums. The art museum charges a one-time fee of $7.25 plus $3.50 per month. - Th
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!