1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elza [17]
3 years ago
15

Por que os primeiros seres eram heterotrofos e anaerobios

Biology
1 answer:
nikitadnepr [17]3 years ago
3 0
<span>Primeiro non rematar a súa pregunta , entón eu non sei como realmente te responder . segundo para cambiar a súa pregunta usar o botón de editar , entón eu vou editar a miña resposta .
 Espero axudar !
</span>
You might be interested in
How can scientists investigate the impact of limiting factors in an ecosystem?
olchik [2.2K]
If the presence or absence of a factor limits the growth of the ecosystems elements, it is called a limiting factor . There are several abiotic factors that limit ecosystem growth, including temperature, precipitation, sunlight, soil configuration, and soil nutrients
4 0
3 years ago
Read 2 more answers
Which lobes of the brain receive input from the nose?
kondaur [170]
The lobes of the brain that receives input from the nose is called the olfactory lobes. They are the ones responsible in receiving the sense of smell. These lobes are responsible in sending signals in the brain in the process of sense of smell.
8 0
3 years ago
How does the number of predators and prey affect relationship in a real ecosystem
Vinvika [58]
It affect The survival and extinction of species
3 0
3 years ago
How can we identify the stages of mitosis in a living cell?
Igoryamba

Answer:

Mitosis consists of four basic phases: prophase, metaphase, anaphase, and telophase. ... These phases occur in strict sequential order, and cytokinesis - the process of dividing the cell contents to make two new cells - starts in anaphase or telophase.

6 0
3 years ago
H1N1 flu is a highly contagious viral infection caused by the influenza A (H1N1) virus. The symptoms of H1N1 flu are listed in t
slava [35]

Answer:

The H1N1 virus replicates quickly.

Explanation:

The H1N1 virus replicates quickly, which is why it is of high importance that an antiviral agent is administrated within the first 48 hours so that the reproduction rate of the virus can be lowered, resulting in an effective treatment against H1N1 flu. In other words, by administrating an antiviral in the first 48 hours, we are helping the body to fight the virus since the antiviral stops the reproduction of it, and we increase the chances of succeeding at it.

5 0
3 years ago
Other questions:
  • Select all that apply. Chromosomes _____.
    13·2 answers
  • "when would a longer quarantine be needed to prevent the spread of an infectious disease?"
    5·2 answers
  • What is longer an era or epoch
    14·1 answer
  • In this field of sunflowers, variation exists. Some flowers are tall, others short, and finally some plants are an intermediate
    12·2 answers
  • Male Australian bowerbirds build and decorate elaborate structures, called bowers, out of grasses and other vegetation. If we wa
    5·1 answer
  • population of squirrels live together in forest an event occurred that caused the population to diverge into two different speci
    6·1 answer
  • How is a dicotyledonous leaf adapted for maximum sunlight and carbon dioxide for photosynthesis? 20 Points if ya help meh out lo
    7·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What kind of neurotransmitter is serotonin ?
    5·1 answer
  • The ________ is the hard protective plate composed mostly of ______. skin, fiber cuticle, protein nail polish, oil onyx, keratin
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!