1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
4 years ago
8

A population of mollusks has lived in a relatively stable environment and shown no great change in many, many years. They live,

die, and get fossilized every few hundred thousand years. Judging from the fossilized snails, little observable evolution has occurred. This is an example of
A) stasis.
B) extinction.
C) natural selection.
D) punctuated equilibrium.
Biology
2 answers:
ra1l [238]4 years ago
8 0
A). Stasis
i look it up for you guys
viva [34]4 years ago
8 0
Yes, it is Stasis. Answer choice A.
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
HeLpP this test is super hard :/
Maksim231197 [3]

Answer:

it cytoplasm.

Explanation:

The cytoplasm helps to move materials, such as hormones, around the cell and also dissolves cellular waste.

4 0
3 years ago
Why is understanding the environment of fossilized organisms important to scientific research?
Pepsi [2]

To understand the environment of the fossilized organism to see what it would have ate or drank anything. in the surrounding area.

8 0
3 years ago
How is hydro electricity produced step by step explanation ​
timama [110]

Answer:

ydropower, electricity produced from generators driven by turbines that convert the potential energy of falling or fast-flowing water into mechanical energy

Explanation:

In the generation of hydroelectric power, water is collected or stored at a higher elevation and led downward through large pipes or tunnels (penstocks) to a lower elevation; the difference in these two elevations is known as the head. At the end of its passage down the pipes, the falling water causes turbines to rotate. The turbines in turn drive generators, which convert the turbines’ mechanical energy into electricity. Transformers are then used to convert the alternating voltage suitable for the generators to a higher voltage suitable for long-distance transmission. The structure that houses the turbines and generators, and into which the pipes or penstocks feed, is called the powerhouse.

6 0
3 years ago
What common type of rock is most susceptible to chemical weathering but resistant to physical weathering
Vlada [557]

I think gravel because it’s the best

6 0
3 years ago
Other questions:
  • Through which of the following body parts do humans take in the energy they need to survive? . A - mouth . B - intestines. C - s
    7·2 answers
  • Why are digestive enzymes in cell enclosed in a membrane-bound organelle
    10·1 answer
  • According to the gel electrophoresis results, which child is most likely the
    9·1 answer
  • Why should we use CER method when approaching a question
    5·1 answer
  • A bird is observed to nest along the coastline. It then spends hours out in the open ocean feeding on fish. What is this behavio
    15·1 answer
  • A scientist thinks that a certain chemical is a mutagen. She exposes plant cells to a large amount of this chemical in the labor
    7·1 answer
  • What can be concluded from the graph? A) The decay in the population is not linear. B) The diseased population increases with ti
    8·1 answer
  • PLEASE HELPPPPPPPPPPPP
    9·1 answer
  • B. What does IPCC stand for?
    11·1 answer
  • All you need to know is in the pic below
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!