Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
The potential mother would be wasting her body's energy and resources constantly producing milk without using it to feed her baby, requiring for her to attain more energy, where she could have just waited until she actually gets pregnant and then start producing milk for her baby once it is close to being or already born.
<span>D. I, III, IV
</span>
ph, Salinity, and Temperature. These three factors could cause an optimum cell function to cease.
Every cell in the body attains homeostasis in many aspects for it to survive and execute the many cellular activities. There are certain organ system that are responsible for such changes and maintenance for the bodily fluids to be at the right and biological level.
Answer: D. Genetic mutation
Explanation:
For evolution to occur, there must be a genetic mutation in the genome of an organism such that a new allele is formed.
If this mutation occurred in the sperm and/or the ovum, the mutation will then be passed on through reproduction to the next generation. This leads to more of the subsequent generations having that mutation thereby leading to evolution.
