1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grandymaker [24]
4 years ago
13

Which of the following best explains why a cell spends most of the time during the cell cycle in interphase?

Biology
1 answer:
worty [1.4K]4 years ago
4 0

Answer:

c) growth of the cell and replication of DNA prepare the cell for division

You might be interested in
In the early 1900s a scientist hypothesized a link between DNA and the production of proteins in the cytoplasm. However, the fac
Vladimir [108]
Let us go over the definitions and the functions of each term:
a) Gene is a bit vague but in general it means a part of DNA that encodes one protein. Genes are the building blocks of our genomes but not the answer to this question.
b)mRNA. This is correct. The name itself means messengerRNA and its role is to copy the genetic information in the nucleus and bring it outside to be translated into protein.
c) ATP is an important molecule in our metabolism; energy is stored in this molecule and then used. It has no relationship to the mechanisms concerning DNA.
d) Thymine is one of the 4 nucleotide bases that are found in DNA, the other three being guanine, cytosine and adenine. They are essential components of a nucleotide (building blocks of DNA and RNA) but again, they do not transfer information out of the nucleus.
4 0
3 years ago
Providing immunity by injecting the body with a weakened form a pathogen is known as
blagie [28]

Answer:

vaccination

Explanation:

The vaccination has been one of the most revolutionary inventions in the medical field. This invention helped protect people from numerous diseases, some being totally neutralized, while some having only minor effects on the human body. The vaccination basically is a way of enhancing the immune system of the body by injecting in it a weakened form of the pathogen. In this way, the weakened form of the pathogen is not capable to harm the body, and the body is not fighting against it, but instead the pathogen becomes part of the body and its defense mechanism, so when the pathogen strikes, the body has a counter attack and defeats it.

3 0
3 years ago
Made up of one or more cells
zheka24 [161]
An organism
because ALL organisms are made up of one or more cells! i hope this helped
8 0
3 years ago
A conclusion may be stated
OleMash [197]
Only after an experiment has been run over and over again to
4 0
3 years ago
I’ll mark brainly to the correct answer!
Vlad1618 [11]
The answer is C. They destroy the ozone layer
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which are early (prodromal) clinical manifestations of hepatitis?
    15·1 answer
  • Which of the following correctly compares cloning and gene therapy?
    13·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Why is it important for the U.S. to have an active space program like NASA?
    14·1 answer
  • A niche is part of an organism's habitat.<br><br> True or False?
    8·2 answers
  • Explain how heat can be a source of water pollution.
    5·2 answers
  • Defenition of osmosis in your own words
    15·2 answers
  • Near a stream's source, a stream erodes a piece of rock from its streambed. As the rock is carried down the stream, how will its
    8·1 answer
  • What do lung cancer And emphysema have in common
    7·2 answers
  • What is the concept used to describe the action of muscles that have the ability to contract automatically in anticipation of mo
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!