1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
crimeas [40]
3 years ago
9

While the ovum is on its way to the uterus, a successful mating results in the presence of sperm cells in the fallopian tube. On

e of these sperm cells fertilizes the ovum. How does this event affect the corpus luteum?
Biology
1 answer:
Oksanka [162]3 years ago
7 0
If the sperm cell fertilises the ovum, and implantation does not occur, then the corpus luteum degenerates and it turns into corpus albicans, stopping progesterone secretion. If fertilisation occurs and implantation also, the syncytiotrophoblast, the "root part" of the blastocyst (one of the early structures originated from the zygote), produces a hormone that is called <span>human chorionic gonadotropin (hCG). The hCG is what makes the corpus luteum keep secreting progesterone and maintain itself. The progesterone will then help keep the endometrium and, therefore, allow the development of the embryo to happen.</span>
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
The many species of tree frogs that inhabit forests in the eastern US maintain their genetic isolation from other species by sev
Elena L [17]

Answer:

b. behavioral isolation

Explanation:

It is a type of reproductive barrier that can lead to speciation. Behavioral behavior, such as mating rituals as in when two populations of the same species show some difference in behavior, typically in mating rituals

and signals.

8 0
2 years ago
What is a nonnative species?
kakasveta [241]

Answer:

A species that has no permanent home.

3 0
3 years ago
Read 2 more answers
What is your definition of the word biochemistry
g100num [7]

the branch of science concerned with the chemical and physicochemical processes and substances that occur within living organisms.

3 0
3 years ago
Read 2 more answers
Use the graph below to answer the following question: If slope is calculated using the equation, "m = (y2-y1) / (x2-x1)," what i
lawyer [7]

。☆✼★ ━━━━━━━━━━━━━━  ☾  

slope = (45 - 0) / (6 - 0)

slope = 45/6

slope = 7.5

Have A Nice Day ❤    

Stay Brainly! ヅ    

- Ally ✧    

。☆✼★ ━━━━━━━━━━━━━━  ☾

6 0
3 years ago
Read 2 more answers
Other questions:
  • The sharp, inch-long thorns of the crown-of-thorns sea star are its spines. These spines, unlike those of most other sea stars,
    11·1 answer
  • Does the population size increase or decrease at higher trophic levels in the pyramid
    12·2 answers
  • The offspring {blank} reproduction are more likely to survive changes in the environment.
    7·1 answer
  • I GIVE BRAINLY. Justin is walking around an area that has few trees and many tall grasses.
    5·2 answers
  • Which of the following matches the organisms described with the correct domain?
    7·1 answer
  • If you had to slide a heavy bot across a floor, how would friction affect the amount of work you had to do on the box in order t
    11·1 answer
  • Q1: How do you use a natural ecosystem?
    15·1 answer
  • Amino acids are coded for by triple bases in RNA called_________
    14·2 answers
  • Which of the following is an order of amphibian?
    12·1 answer
  • This is a test for my<br> brainly plus
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!