1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fofino [41]
3 years ago
7

What does it mean when a compound’s chemical formu does not include any numbers

Biology
2 answers:
Bingel [31]3 years ago
4 0
Hello!

That means that for each element in the formula is single. 

For example:

K   +   Cl   ==>   KCl

There is only one of each element  (K and Cl).

I hope this helps :))
postnew [5]3 years ago
3 0
Usually when there are no numbers which are called subs-cribs the equation is not balanced meaning you have to make sure there are equal amounts of each element.<span />
You might be interested in
Sand for beaches comes from rocks in the area that are weathered down, and
hichkok12 [17]

Answer:

Beaches would shrink until they were no longer there because the sediment is pulled away from the shores by the tide and there would be no new rock sediment to replace the old rock sediment.

7 0
3 years ago
The combination of natural resources in a forest (air, light, soil, water) determine ______________.
8_murik_8 [283]

Answer:

A.

Explanation:

Group of answer choices

5 0
3 years ago
What are some methods you could use to measure the amount of white in every juncos tail feathers imagine you had the equipment p
statuscvo [17]

Answer:

Evolution is the process that allows the appearance and elaboration of signals, but the key question is: what selective forces led - and lead - to the appearance of color characteristics and chromatic patterns ?, not only in the scope of a species concrete - such as the black bib of the common sparrow (Passer domesticus) - but also within each family or even within a wider framework, for example the light colored spots that we see in the outer feathers of the tail of the bird species Dr. Senar explains the methods and results of the experiments performed so that the reader can compare their interpretation with the scientific advocacy, but also involve other alternative hypotheses. For example, the supposed signals of dominance Do they represent correlations with age and sex, which in turn correlate with dominance? And what can we say about deception, of those signs that exaggerate the status of an individual? The presentation of the different alternatives offers the reader the opportunity to detect the complexity of the selective forces and the difficulty of designing clear and conclusive experiments. In a similar way, the author presents the multiple hypotheses that address sexual selection and delayed maturation of plumage, thus facilitating the reader, understanding of the different topics discussed and a better appreciation of the elegant experiments that have been used to formulate and defend some of these hypotheses. Camouflage is treated in a separate chapter, but Dr. Senar not only focuses on the colors of the prey, which affects the object of investigations, but also on the color of predators, whose study has been the subject of much attention minor The interpretation of color as a bioindicator is an innovative approach that is proposed towards the end of the book. This is the first time that this possibility was raised, but, as the author points out, if the birds determine the quality of the habitat by the color of the potential couple that lives in it, there is no doubt that we should also be able to determine the quality of a habitat using similar means. Experiments that allow us to evaluate this approach are described throughout the book.

7 0
4 years ago
Write out the molecular formula and Lewis structure for cyanide
kondaur [170]
CN- the minus goes on top but that should be correct!! 
4 0
3 years ago
Read 2 more answers
What is the longest period of time anyone has gone without oxygen
Snowcat [4.5K]
The longest period of time is 11 minutes and 35 seconds.
8 0
4 years ago
Read 2 more answers
Other questions:
  • Maria se cayó en su baño, se golpeó la cabeza y esto le ocasionó no poder ver ni escuchar.
    12·1 answer
  • Which two organisms are most closely related, based on the tree above?
    13·1 answer
  • Please help I’m very confused on what to do or say
    11·1 answer
  • A type of cell the immune system uses to fight infections is: myelogenous cells B-cells T-cells RTV-cells
    11·1 answer
  • What is the current universal naming system used for naming organisms, who created it, and how does it work?
    7·1 answer
  • [CM.05]The people in a location in Florida are stocking non-perishable food items and emergency kits in their homes and covering
    5·2 answers
  • What do genes basically do?
    14·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Sea turtles, mosquitoes, and frogs all show a
    6·1 answer
  • Some individuals can develop kidney failure after consuming fava beans. What is the biochemical rationale for this observation?A
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!