1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
I am Lyosha [343]
3 years ago
6

True/false:Meiosis only occurs in females

Biology
2 answers:
Allushta [10]3 years ago
8 0
The answer is going to be false. hope that helped
elena-s [515]3 years ago
4 0
Im pretty sure that its true but double check
You might be interested in
A group of students were looking at an eclipse drawing done by a classmate. They each thought it was a different type of eclipse
Yuliya22 [10]

Answer:

Meredith is correct

Explanation:

A lunar eclipse occurs when the Sun, Earth, and Moon align

3 0
2 years ago
Describe TWO WAYS technology has created more waste by humans.<br><br><br>I need an answer now.
Murljashka [212]

Answer:

<u><em>Hazardous type: </em></u>This type poses potential threats to the environment and human life. Battery wastes from thrown away technology.

<em><u>Electronic waste</u></em> or <u><em>e-waste</em></u> describes discarded electrical or electronic devices. Used electronics which are destined for refurbishment, reuse, resale, salvage recycling through material recovery, or disposal are also considered e-waste.

4 0
3 years ago
7. Dual purpose breed of goat-<br>(A) Barbari (B) Jamnapari<br>(C) Marwari (D) Beetul​
Vilka [71]
The answer to the question is Jamnapari
4 0
3 years ago
Your study group is in the midst of a discussion on fungi. One of your classmates emphatically states that animals and fungi do
mina [271]

Answer:

The argument can be contradicted by assuming that both animals and fungi exhibit heterotrophy and have intracellular spindles.

Explanation:

If an argument is required to demonstrate that fungi have common characteristics, it can be taken into account that:

  1. <em>They are</em><em> heterotrophic organisms</em><em>, since they are not able to synthesize their own nutrients, such as plants. </em>
  2. <em>Both </em><em>have intracellular spindles</em><em> in their structure, useful when performing the corresponding cell division. </em>
  3. <em>Additionally, both animals and fungi can </em><em>store glycogen</em><em> as a reserve of energetic substrate.</em>

It is currently thought that fungi and animals have a convergent or parallel evolution.

Learn more:

Fungi characteristics brainly.com/question/942950

8 0
3 years ago
Is Turritopsis dohrnii capable of bioluminescence?
ELEN [110]

Answer:

A. Yes Turritopsis dohrnii is capable of bioluminescence.

Explanation:

6 0
2 years ago
Other questions:
  • Which website allows individuals to search for suitable job profiles and employers?
    5·2 answers
  • A cell biologist measures the volume of a bacteria cell. the volume is . what is the volume in picoliters?
    7·1 answer
  • How is gravity affected by mass and radius?
    6·1 answer
  • 10 points and brainliest!
    14·2 answers
  • Identify the cell organelles found only in plant cells and those found in both animal and plant cells.
    14·2 answers
  • You examine an unknown cell under the microscope and discover that the cell
    12·1 answer
  • Which has more potential energy or are they the same, an apple on top of a tree, or one halfway down?
    5·1 answer
  • If three bases are required to code for one amino acid, how many bases long must the gene be to encode a protein 400 amino acids
    5·2 answers
  • What are the three parts of modern cell theory. Choose all that apply.
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!