1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
2 years ago
10

Help will mark brainlist

Biology
1 answer:
KengaRu [80]2 years ago
8 0

.dont taste or sniff chemical

Tasting and smelling some chemicals can be dangerous and even deadly.the best way to know what is in a container is to label

. Don't play mad scientists

This result in mixing chemcals to see what happens the result could be explosion ,fires,or releasing toxic chemicals

.Dress for the lab

This is a safety rule because clothing is one of your best form of protection against an accident wear covered shoes,long pants,and keep your hair tied so it cant fall into your experiment

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
M. F<br> Which of the following is generally true of parasites?<br> (A)They give their host a competitive advantage<br> (B) They
Dvinal [7]

Answer:

D

Explanation:

Parasites do not directly kill their host

6 0
2 years ago
Read 2 more answers
What is the greenhouse effect?
Anton [14]

Answer:

B.

Explanation:

due to the greater transparency of the atmosphere to visible radiation from the sun than to infrared radiation emitted from the planet's surface.

3 0
2 years ago
Why does the south and north have opposite temperatures?
Doss [256]
They Have Different Temperatures during the seasons because of the earths tilt on the axis towards the sun. When The Northern Hemisphere of the earth Is tilted towards the sun, it warms it up, but if its tilted back it will be cold, same for the south!
6 0
3 years ago
Read 2 more answers
Identify clues you would look for to judge whether a claim is based on science or pseudoscience.
vekshin1
If a claim is based on science, it will have a lot of scientific experimentation, replication of results, peer view, and proofs obtained from a lot of researches that substantiate investigated theory. However, if a claim is based on pseudoscience, instead of evidence that supports a theory, there would be claims that doesn’t follow specific criteria.

this is what i got from google
4 0
3 years ago
Other questions:
  • Can the rate or speed of photosynthesis change based on how much of those reactants are available?
    12·1 answer
  • If you are asked for advice on whether diets high in fiber can reduce colon cancer risk, what would you reply
    12·1 answer
  • Plants do not just use photosynthesis to make sugar for energy storage. Identify other kinds of uses plants have for these subta
    15·1 answer
  • Which gas in Earth's atmosphere helps living things make proteins?
    11·2 answers
  • A milestone can be a deliverable but it need not be. true or false
    10·2 answers
  • True or False: Alex used her fingers to remove the lid from a can of vegetables after he opened it with a can opener. Sophia kno
    13·1 answer
  • Why did i lose all my Brainly progress and points and it says that I have no questions or answers?​
    10·1 answer
  • How do earthworms get oxygen to their cells?
    14·1 answer
  • Define adaptation in plants?​
    8·1 answer
  • Why are hooves more advantageous for horses in the modern era? (1 point)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!