1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seraphim [82]
3 years ago
11

The tendency to respond to a stimulus that is similar to the original conditioned stimulus is called _____________.

Biology
1 answer:
german3 years ago
5 0
Stimulus generalization
You might be interested in
HELP <br><br> Why is sea temperature important?
Snezhnost [94]

Explanation:

Sea surface temperature provides fundamental information on the global climate system. ... SST is an essential parameter in weather prediction and atmospheric model simulations, and is also important for the study of marine ecosystems. SST data are especially useful for identifying the onset of El Niño and La Niña cycles

8 0
2 years ago
Read 2 more answers
What happens to energy as you move up food chain
geniusboy [140]
As you move up to the food chain, the energy will decrease. This explains  that the more the consumers, the lesser the energy that the last consumer will get from the sunlight. This is because each energy will decrease as it passes by the consumers because each consumers takes a portion of the full energy from the sun.
5 0
3 years ago
Read 2 more answers
Which organs stores the bile from the liver until it is needed in the small intestine?
Amiraneli [1.4K]

Answer:

liver

Explanation:

4 0
3 years ago
What are alll examples for sexual reproduction ​
sp2606 [1]

Im not sure what the question is could u further define or give me the possible answers

5 0
3 years ago
Read 2 more answers
A tourist boat accidently dumps its fuel in to the water around a coral reef. Write a 75 word essay describing one or more possi
klemol [59]
The fuel will affect the environment and ocean. Oil spills can harm sea creatures and make seafood unsafe to eat. The oil can kill coral which can affect the animals who live next to the corals such as crabs and fishes.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which medicine is most likely to directly interfere with pepsin’s function
    8·1 answer
  • DNA has unique properties that allow it to accurately retain genetic information, even after multiple rounds of replication. One
    12·1 answer
  • One of the greatest expenses involved with the use of hazardous materials in industry is the _____.
    14·2 answers
  • At which time does the nurse anticipate that the woman will need the most pain relief measures
    9·1 answer
  • What was the purpose of the Declaration
    8·1 answer
  • A researcher is trying to create an artificial, eukaryotic cell-like membrane within the laboratory. She wants this membrane to
    8·1 answer
  • Describe the concept of natural selection, using the Galapagos finches as an example. Imagine you were trying to explain the con
    10·1 answer
  • An example for aheterotropic for feeding is what
    14·1 answer
  • Explain why there is glucose ni urine​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!