1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
3 years ago
14

What type of human activities cause the elevation of atmospheric greenhouse gases

Biology
1 answer:
Leto [7]3 years ago
6 0
The amount of greenhouse effect on Earth is directly proportional to the concentration of greenhouse gases in the atmosphere. In this era of industrialization, although it may seem that it has greatly improved the global economy, it also downplays the importance of consistently upholding our role as a steward to Earth. 

The most common types of human activities that continuously worsen the greenhouse effect are: burning of fossil fuels, agriculture, and industrial processes.

The burning of fossil fuels such as coal, oil, and gas emits carbon dioxide which accounts for approximately three-quarters of the warming impact caused by the greenhouse gas emissions. This is amplified significantly through deforestation. 

Methane, which accounts for 14 percent, and nitrous oxide, which accounts for eight percent are one of the major greenhouse gas emissions on earth. This can be sourced out from livestock and rice fields and also fossil fuel extraction and organic waste decay in landfill sites.

Industrial processes would incept fluorinated gases which accounts for one percent of the warming effect of current human greenhouse gas emissions.

Although it may seem that the values are not that high, but it must also be taken into consideration the several or a superfluous number of industries all around the world that simultaneously worsens the already groveling site of the continuously deteriorating and exploited planet Earth.
You might be interested in
Which of the following are part of the chemiosmotic coupling model? Protons are pumped out of the mitochondrial matrix into the
Lina20 [59]

The correct answer is: Protons are pumped out of the mitochondrial matrix into the intermembrane space

Chemiosmosis can be described as movement of ions across a selectively permeable membrane, down their electrochemical gradient. It occurs during the cellular respiration within mitochondria and it is involved in ATP synthesis (oxidative phosphorylation via ATP synthase).

Electrons from electron carriers (NADH and FADH) donate electrons to the electron transport chain and that causes changes in protein complexes of electron transport chain. As a consequence, protein complexes pump H+ across a selectively permeable cell membrane from the mitochondrial matrix into the intermembrane space of mitochondria.  

H+ can only get back and pass through the inner mitochondrial membrane with the help of ATP synthase (down their electrochemical gradient). ATP synthase turned by the force of the H+ diffusing through it forms ATP by adding a phosphate to ADP.

4 0
3 years ago
How does the human brain interpret and render the surroundings and state of the body?
ollegr [7]
Through electrochemical processes
5 0
3 years ago
Which statement correctly describes the difference between a polar covalent bond and a nonpolar covalent bond?
Sauron [17]

Answer:

D: Nonpolar covalent bonds involve two atoms that have equal electonegativity whereas polar covalent bonds involve two atoms that are unequal in their electronegativity.

Explanation:

5 0
3 years ago
Read 2 more answers
Can someone explain eukaryotic cells and prokaryotic cells like you’re talking to a 5 year old?
Fed [463]

Eukaryotic cells do not have a nucleus. The nucleus is where DNA, your genetic material, is usually stored. Prokaryotic cells do not have a nucleus. The DNA just floats around the cell instead of staying in one designated area.

6 0
3 years ago
What happens to the rate of photosynthesis when carbon dioxide is increased?
pychu [463]
We get weaker because put yourseld undersoemthing but not too long bc youll pass out but youll notice youll get weaker. so theres your answer buddy.
5 0
3 years ago
Other questions:
  • Why is it important to classify the millions of species on earth?
    15·1 answer
  • Someone plz help with this inquiry skill question. Thank you
    13·1 answer
  • The fundamental sedimentairy rock unitcan be normally traced for long distances
    12·1 answer
  • What action is least helpful in dealing with a friend who abuses drugs? answers?
    5·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Do you think ancient Antarctica was situated in a different location from its location today? Why or why not?
    13·2 answers
  • True/ False: Other than gametes in eukaryotic cells, each somatic cell contains a complete set of an organisms genome which is w
    13·1 answer
  • The molecule that carries amino acids to the ribosome and binds to a mRNA ensuring a proper amino acid sequence in the resulting
    10·1 answer
  • Federal aid for the U.S. Fish and Wildlife Service stems from the ____
    10·1 answer
  • What is the relation between chromatin ,dna,gene,chromosome?pls answer in simple words ​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!