1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
3 years ago
7

A client is concerned about tripping when walking and feeling uncoordinated. which part of the brain might be causing this clien

t’s symptoms?
Biology
1 answer:
Archy [21]3 years ago
6 0

The part of the brain the causes the client’s symptoms is the cerebellum. It is because she or he is having trouble to control or coordinate movements and the balance control in which the cerebellum is responsible of coordinating functions.

You might be interested in
Why do some leaves turn from green to red, orange, or yellow in the fall?
11111nata11111 [884]

Answer:

Chlorophyll Breaks Down

Explanation:

because of changes in the length of daylight and changes in temperature, the leaves stop their food-making process. The chlorophyll breaks down, the green color disappears, and the yellow to orange colors become visible

U 2 can help me by marking as brainliest......

7 0
3 years ago
Explain why there might be some resistance to the use of biotechnology.
Anuta_ua [19.1K]

Although the application of biotechnology has many potential advantages, it also has potential risks. These risks include increased resistance of insects and microorganisms, overproduction of new plants, and competition with natural organisms. Some individuals may not believe that the benefits of biotechnology outweigh the risks.

This is the exact answer on edge

6 0
3 years ago
Read 2 more answers
_______ is a measure of the different types of organisms in a community.
lord [1]
None of the above? I’m guessing, secondary, primary and tertiary doesn’t sound right !
5 0
3 years ago
The ________ plate count (SPC) method involves diluting 1.0m of bacterial culture into a series of water blanks, and then taking
Anna11 [10]

The standard plate count (SPC) method involves diluting 1.0m of bacterial culture into a series of water blanks, and then taking a sample from the water blanks to add to empty petri plates which will be filled with melted agar.

The standard plate count is a method used in microbiology, which is used to gain an insight to estimate the density of bacterial population which is present in a bacterial culture broth. This is done by plating a small concentration of the culture in a petri-dish and then counting the colonies which form in the petri-plate. This method is used mostly in the food industry, to find the density of mesophilic bacteria in food. This method is extremely essential to determine the primary source of the bacterial contaminant.

Learn more about standard plate count here-

brainly.com/question/14803589

#SPJ4

3 0
2 years ago
What is the term when the mother voluntarily terminates a pregnancy? spontaneous abortion artificial insemination abortion misca
olchik [2.2K]
<span>The term used when a mother makes the decision to terminate a pregnancy is abortion. This term means that the pregnancy will come to an end via removing the embryo or fetus prior to any time that it is capable of surviving on its own outside of the uterus.</span>
4 0
4 years ago
Other questions:
  • Responding to the environment by maintaining a stable internal environment despite changing external conditions is
    12·2 answers
  • It is important for _______ to participate in conservation efforts
    9·1 answer
  • Which part of an amino acid is the only one that varies and is what defines its properties? A. The amino group B. The R group C.
    13·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Jacob is studying cell organelles. He knows that light energy drives photosynthesis. Look closely at the diagram below.
    11·2 answers
  • Place the ruler over the sphere. What is the diameter of the sphere?
    15·1 answer
  • ILL MARK AS BRAINLIEST!!adding a catalyst to a reaction ___ the amount of energy needed for the reaction to occur and it ___ the
    12·1 answer
  • What is the function of gills and lungs in aquatic animals
    14·2 answers
  • The small blood vessels that distribute blood throughout the entire body are
    7·1 answer
  • Which technique cannot be used to analyze gene expression?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!