1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jarptica [38.1K]
4 years ago
10

Which terms are associated with the conservation of mass? Select all that apply.

Biology
1 answer:
Maslowich4 years ago
7 0
Equal and persevered transformed
You might be interested in
In the Calvin cycle, ATP and NADPH are used to make glucose. What is the
neonofarm [45]
Light energy is initially converted into chemical energy in he form of two compounds: NADPH, a source of energized electrons and ATP, the versatile energy currency that the light reactions produce no sugar, that happens in the second stage of photosynthesis, the Calvin cycle.
8 0
4 years ago
Compare the relationship humans have with Earth’s atmosphere to
Mila [183]

Earth's atmosphere provides protection, breathing, and the cycling of elements to humans.

<h3>Relationship humans have with Earth’s atmosphere</h3>

The fundamental relationship between humans and nature is the ongoing exchange and change of resources, the service nature and humans provide to each other. Humans provide carbondioxide to the atmosphere whereas atmosphere provides oxygen for breathing.

It also provides nitrogen to the soil due to which plants produce amino acid and provides  food to us. Earth's atmosphere such as ozone layer provides protection from ultraviolet radiation.

Learn more about humans here: brainly.com/question/24466312

6 0
3 years ago
What occurs with both cold front and a mountain breeze
attashe74 [19]
The correct answer for the question that is being presented above is this one: "c. Clouds tend to form." When both the cold front and the mountain breeze, then c<span>louds tend to form. These clouds carry a lot of water that will eventually stores water that serves as rain.</span>
8 0
3 years ago
What types of experiments were required to determine if the penicillium extract was safe and killed bacteria?
Marta_Voda [28]
 Alexander Fleming discovered the penicillin in 1928. He noticed that some bacteria he had left in a petri dish had been killed by naturally occurring penicillium mould.The penicillin began the era of antibiotics, has been recognized as one of the greatest advances in therapeutic medicine. The research required to determine if the penicillium extract was safe and killed bacteria was done at Oxford University.P<span>rogram of animal experiments and clinical trials was carried.</span>
5 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
Other questions:
  • If you know that a population is 75% the dominant phenotype and 25% is the recessive phenotype, can you determine approximately
    5·1 answer
  • Flock X Flock Y Flock Z Total Pieces of Food Eaten (from previous page) 123 99 78 Food Percentage*  %  %  % Simulated Number of
    7·1 answer
  • Which of the following is always single stranded?<br> dsRNA<br> DNA and RNA<br> DNA<br> mRNA
    15·1 answer
  • What body systems remove toxins from the body?
    10·1 answer
  • Which of the following describes research that would be considered basic science
    12·2 answers
  • A tissue has the following characteristics: free surface, single layer of cells, cells are narrow and tall, microvilli, many mit
    14·1 answer
  • What field of biology that works on rewriting and editing the genetic code
    9·1 answer
  • The nutrition label shows the total amount of carbohydrates in grams. One gram of carbohydrates provides four calories of energy
    6·2 answers
  • The ATP produced by a plant cell is made in the process of CELLULAR RESPIRATION which occurs in the
    8·2 answers
  • Does photosynthesis remove take or use co2 from atmosphere?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!