1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yanka [14]
3 years ago
10

If someone is a proven performance-enhancing drug user is eligible for the Hall of Fame in any of the major professional sports,

should they be elected? Should there be rules that ban such athletes from eligibility?
Biology
1 answer:
antiseptic1488 [7]3 years ago
3 0
This is a issue of morality and ethics. So the answer to the first question depends on the perspective of the person. Personally I don't agree with performance enhancing drug use but I do think some of the expectations of athletes who perform in Olympic events increase the pressure to have to use them. So do I think people who use these drugs should be elected into the Hall of Fame. That is hard to answer. But I do not think using drugs takes away all of the achievement an athlete has made. It just proves that the athlete couldn't achieve the rigid sport performance without manipulation. But it doesn't mean they haven't worked hard or trained.

I do think rules should be made for athletes. These rules would definitely weave through most of the athletes we see doing these out of the world sport records every day. That is because many of them have been proven to have used these performance enhancing drugs.

Please vote my answer brainliest. thanks!
You might be interested in
I don't get the carbon dioxide cycle ​
Lapatulllka [165]
I’ll help if you want
5 0
3 years ago
A postganglionic neuron in the ANS __________.
Ede4ka [16]

Answer:

a) releases neurotransmitter that binds to the effector cell

8 0
3 years ago
Speed in a given direction is called
nadya68 [22]
It is called velocity 
7 0
3 years ago
How many wilderness areas are there in the United States?
nexus9112 [7]
765 wilderness areas in the U.S.
5 0
3 years ago
Read 2 more answers
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Other questions:
  • All cells _____.
    9·2 answers
  • What characteristics do mutations have ?
    15·1 answer
  • Can someone help please (biodiversity and conservation) assignment part 1
    14·1 answer
  • A stimulus type that occurs within the organisms body is
    10·1 answer
  • Scientists produce plants from tissue culture in the lab. The new plants are produced under sterile conditions, to produce clone
    9·2 answers
  • 3. Name a cellular process that maintains homeostasis, and write 3 sentences explaining that process
    14·1 answer
  • By which process are fossil fuels formed?
    9·2 answers
  • Gene mutations can be passed on to future generations and drive natural selection. Choose the best description of how Gene mutat
    9·1 answer
  • How an ecologist predicts the size of a population without counting every organism in the population?
    14·1 answer
  • The immune system uses _____ to combat bacteria and other foreign substances in the body.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!