1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TEA [102]
3 years ago
9

Corn smut and wheat rust are crop diseases caused by what what fungi

Biology
2 answers:
Dominik [7]3 years ago
8 0

Answer:

Club fungi

Explanation:

Hitman42 [59]3 years ago
6 0
2. club fungi
explanation:

Corn smut is caused by Ustilago maydis while wheat rust is caused by Puccinia triticina. Both Ustilago maydis and Puccinia triticina are classified under division Basidiomycota. Basidiomycota is also called as club fungi. These fungi form specific club-shaped fruiting bodies called basidia. Basidia are the site for the formation of basidiospores.
You might be interested in
What is a cause of nonpoint-source pollution?
Zigmanuir [339]
Your answer will be (A)
5 0
3 years ago
Read 2 more answers
Would an ecosystem be sustainable with the majority being made up of secondary consumers?
brilliants [131]

Answer:

Explanation:

I don't think so

8 0
2 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Science has shown how information can only be gathered by the known laws of physics and chemisty.
8_murik_8 [283]
I would say the answer is false because they also used information of science to help make things like medicine and fungi and fossils, one of the main things science was used for was chemistry and physics to determine what things could kill humans in the world back in the day.


Hope this helps, Have a good day:), ~Nana!~
6 0
3 years ago
If bryophytes do not have vascular tissue how can some mosses reach 60 centimeters tall
nataly862011 [7]
They can grow tall, 60 cm plus
4 0
3 years ago
Other questions:
  • A pipe spilling chemicals from a factory into a river is an example of a point source of pollution true or false?
    12·2 answers
  • Which change would occur over the longest amount of time?
    8·2 answers
  • 1. Describe how water moves through the water cycle.
    10·2 answers
  • I need to know some interesting about robosome
    9·1 answer
  • Birth-control pills prevent pregnancy by interfering with the usual feedback cycle between the ovaries and the pituitary.
    13·1 answer
  • The phosphate transport system in bacteria imports phosphate into the cell even when the concentration of phosphate outside the
    12·1 answer
  • The bat-eared fox has 30 chromosomes in its body cells. when the fox's body cells divide by mitosis, how many chromosomes will e
    15·2 answers
  • What technologies did scientists not use to develop the theory of seafloor spreading
    6·1 answer
  • All of the following are examples of physiological motives or drives except ___________. A. hunger B. acceptance C. sleep D. thi
    12·1 answer
  • How do drugs produce their action in the body?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!