Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
<span>An amphibian that lacks lungs and breathes entirely through its skin would have to be smaller than an amphibian with lungs so that the small oxygen intake correlates with
the small surface area of the amphibian. This would then allow it to breath efficiently.</span>
No doubt, the United States is a powerful country in the world today. It has made its mark in the history by building a strong economy that every other nation envies, and idolizes as well. But, all that glitters is not gold. And every country has its pluses and minuses. There are some serious social issues in the United States as well that need to be dealt with to maintain the position of power and prestige, and set a true example of ideal society in the world.
<span />
PH changes protein structure if the pH level is below seven which is acidic and or above seven which is basic. The best condition for the enzyme to work is the pH of seven this is where the protein carries out its function and is not denatured. It fits into the enzyme
Answer:
A gene is a stretch of DNA that helps to control the development and function of all organs and working systems in the body.
Genes are passed from parent to offspring; the combination of these genes affects all aspects of the human body, from eye and hair color to how well the liver can process toxins.
