1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VMariaS [17]
3 years ago
8

The diagonal arrow of a cladogram shows us that we are moving _________ in time.

Biology
2 answers:
Nonamiya [84]3 years ago
6 0
Forward ..............................
Step2247 [10]3 years ago
3 0

The diagonal arrow of a cladogram shows us that we are moving forward in time.

You might be interested in
Glucose,fructose,and sucrose are all carbohydrates. what elements make up all carbohydrates?
PolarNik [594]
All carbohydrates are made up of carbon, oxygen, and hydrogen.

The chemical formula for Glucose is C_{6}  H_{12}  O_{6} .
The chemical formula for Fructose is the same as that of Glucose. The difference between the two is how they are structured.
The chemical formula for Sucrose is C_{12} H_{22}  O_{11} .

As you can see in the chemical formulas of Glucose, Fructose, and Sucrose, they are all made up of the elements carbon, hydrogen, and oxygen.
5 0
4 years ago
Read 2 more answers
Need an answer now explain answer the 1-4 questions ​
guajiro [1.7K]

Answer:

yes it is true

Explanation:

my hand

7 0
3 years ago
Read 2 more answers
C4 plants occur more commonly in desert conditions because _____. a. they can fix carbon at the lower CO2 concentrations that de
ahrayia [7]

Answer:

a. they can fix carbon at the lower CO2 concentrations that develop when the stomata are closed

Explanation:

C4 plants are those that have the capacity to fix CO2 even when a tiny concentration of it is available.

Desert condition is characterized by dryness and strong heat with both condition capable of creating water stress in plant as a result of evapotranspiration. In order to reduce evapotranspiration rate, desert plants (most C4 plants) close their stomata during the day.

<em>Stomata closure limit the diffusion of CO2 into desert plants and the small concentration of CO2 that results is utilized by a special enzyme in the plants.</em>

The correct option is a.

6 0
3 years ago
Read 2 more answers
Please help will give brainless !!!!!:)
Anestetic [448]

Answer:

they start to run out of places to stay cool and then will eventually run out of food to eat then they will die. hope this helps

7 0
3 years ago
What monomer is made up of a base, a sugar, and a phosphate group?
Cloud [144]

Nucleotide would be the answer

6 0
3 years ago
Read 2 more answers
Other questions:
  • Explain one medical reason why balanced diet may vary
    11·1 answer
  • Varicose veins seen in the superficial veins of the legs are unsightly and are often treated by surgical removal. However, even
    10·1 answer
  • When it is summer in Sydney, Australia what season is it in Montreal, Canada? Explain your reasoning.
    10·2 answers
  • A hernia in the groin area is called a/an
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which processes are directly responsible for the presence of the different species of wheat and corn shown in the diagram above?
    8·1 answer
  • Based on the context, stimulus refers to-
    11·1 answer
  • Principal cambio químico explicado por lavoisier
    7·1 answer
  • Explain the relationship between autotrophs heterotrophs and decomposers In 4 to 5 sentences
    10·1 answer
  • Temperatures on Mars reach as high as 20 °C and fall as low as –140 °C. That temperature is colder than anyplace on Earth. Tempe
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!