1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
3 years ago
11

What is one common feature of domain bacteria

Biology
1 answer:
enot [183]3 years ago
5 0
I would say it is there dna is not inclosed in a mebrane
You might be interested in
___________ promises to solve many medical problems with new drugs and procedures that will contribute to the spiraling costs of
antoniya [11.8K]

Answer:

Biotechnology.

Explanation:

Biotechnology may be defined as the field of biology that uses the living organisms to make product by using molecular techniques. Biotechnology involves the different field like  biomedical engineering, biomanufacturing and bioengineering.

The genetic system of the living organism can be modified to obtain the desired products. Artificial insulin is prepared by the application of biotechnology. The new drugs in the market and desired trait in the living organism can be prepared by the biotechnology field.

Thus, the correct answer is biotechnology.

8 0
3 years ago
What is pushing apart North America and Eurasia?
Slav-nsk [51]

Answer:

The North American and Eurasian Plates are moving away from each other along the line of the Mid Atlantic Ridge. The Ridge extends into the South Atlantic Ocean between the South American and African Plates.

4 0
3 years ago
Does the stomach only does chemical digestion to break down food?
bonufazy [111]
In the stomach, food undergoes chemical and mechanical digestion. Peristaltic contractions (mechanical digestion) churn the bolus, which mixes with strong digestive juices that the stomach lining cells secrete (chemical digestion). As food travels from your mouth into your digestive system, it's broken down by digestive enzymes that turn it into smaller nutrients that your body can easily absorb. This breakdown is known as chemical digestion.
8 0
3 years ago
The worst thing that can happen in the modern environmentalism according to Jones is
lara31 [8.8K]
<span>worst thing that can happen in the modern environmentalism according to Jones is that how people treat will respond to you based on your color and status. People think that you are stupid because you are poor, that's why the amount of help that poor people receive if there's a disaster is very limited.
 </span>
7 0
3 years ago
A calorie is the commonly used unit of chemical energy. It is also the unit ofA. radioactivityB. lightC. heatD. sound
just olya [345]
Heat — its the amount of heat energy required to raise a kilogram of water by 1 degree Celsius.
6 0
4 years ago
Read 2 more answers
Other questions:
  • When a cat drops from a tree to the ground, the conversion of takes place. Then cat runs up behind a mouse to obtain its food. A
    8·2 answers
  • What organelles/cells houses the genetic material? ...?
    10·1 answer
  • Which of the following statements accurately describes the process of dating Earth's history?
    11·2 answers
  • A plant with purple flowers is allowed to self-pollinate. generation after generation, it produces purple flowers. this is an ex
    10·1 answer
  • How might a scientist display data on the territories of different groups of chimpanzees? What would this be an example of?
    8·1 answer
  • How has technology chamged farming
    7·1 answer
  • in the carbon cycle, plants use energy from the sun to convert _____________ from the air into organic material that becomes a p
    13·2 answers
  • On a backpacking trip, Kenny hikes all day at a steady pace, covering 30 kilometers and burning 4000 Calories. At the school tra
    5·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • If matt and sarah have 10 children why do they all end up genetically different?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!