1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dimas [21]
3 years ago
7

Fine sediment a) deflation b) loess c) sand dunes d ) deposition

Biology
1 answer:
Galina-37 [17]3 years ago
6 0
Fine sediment deposited by wind is B) loess

Hope this was helpful
You might be interested in
Some llamas have curly fur and some have straight fur. when a llama dad with curly hair is crossed with a straight haired llama
Alik [6]
X is the dominant allele / curly hair , females have two X chromosomes and males have an X and  Y
7 0
3 years ago
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t
wel

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

8 0
3 years ago
What functions do endocytosis and exocytosis carry out for the cell ?
Genrish500 [490]
Endocytosis carry substances into the cells, and exocytosis is what the cell rejects.
3 0
3 years ago
Brad seems to be in a continuous state of anxiety, though he is unable to identify the source of his feelings. the most likely d
melamori03 [73]

Answer:

Generalized anxiety disorder

Explanation:

5 0
3 years ago
A Virus Is A Piece Of __________ Enclosed In A Capsid.<br> A) DNA<br> B) Protein<br> C) Nucleic Acid
SVETLANKA909090 [29]
This would actually be known to originate in the "nucleic acid". This would have nothing to do with the DNA it's self, and also protein has nothing to do with it also.<span>Nucleic Acid would be small particals in the cells that would consists of molecules would some sort of chain which would then lead to the DNA, but it would actually have not resemblance of the nucleic acid at any point.

</span>A Virus Is A Piece Of <span>Nucleic Acid</span> Enclosed In A Capsid.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these describes a quantitative observation?
    14·1 answer
  • Compare and contrast diffusion to osmosis.
    8·1 answer
  • Bone contains living cells and organic matter such as collagen, protein, and polysaccharides. However, much of the volume of bon
    7·1 answer
  • Explain how the career area of respiratory therapy relates to our study of oxygen and lung volumes. provide an example that illu
    14·1 answer
  • Gregory wants to make a hole in a flat piece of wood. He places object Y on the piece of wood, and then object X on top of it.
    12·1 answer
  • DNA replication is Group of answer choices conservative. a one-step process. semi-conservative. not carried out by enzymes. not
    10·1 answer
  • Suppose a white-furred rabbit breeds with a black-furred rabbit and all of their offspring have a phenotype of gray fur. what do
    14·1 answer
  • Ttybbe&amp;cr edddbehegeheehwwwyyww
    6·1 answer
  • All of the following are considered to be part of the biosphere, except __________.
    10·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!